Cart 31 Product Products 5 872,12 € (empty)
-
1 x NSMCE4A-no...121,50 € -
1 x PPIL3-pept...113,40 € -
-
1 x NMUR2-neur...121,50 € -
1 x SCAND2-SCA...113,40 € -
1 x MAGEC3-mel...121,50 € -
1 x SRP9-signa...113,40 € -
1 x NME4-non-m...113,40 € -
1 x SLC25A16-s...113,40 € -
1 x DOC2A-doub...121,50 € -
-
-
-
-
1 x ZNF672-zin...113,40 € -
1 x NIP30-NEFA...113,40 € -
1 x MSRA-methi...113,40 € -
1 x LOC1001295...113,40 € -
-
-
1 x SLC25A10-s...121,50 € -
1 x ZNF611-zin...113,40 € -
1 x C18orf1-ch...113,40 € -
-
-
1 x TWF2-twinf...121,50 € -
1 x NUCB1-nucl...113,40 € -
1 x VEGFA-vasc...113,40 € -
1 x FLJ13224-h...113,40 € -
-
No products
To be determined Shipping
5 872,12 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 31 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 872,12 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 872,12 €
Data sheet of HRSP12-heat-responsive protein 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HRSP12-heat-responsive protein 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010280 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HRSP12 |
| Origin species: | Human |
| Product name: | HRSP12-heat-responsive protein 12 Gene |
| Size: | 2ug |
| Accessions: | BC010280 |
| Gene id: | 10247 |
| Gene description: | heat-responsive protein 12 |
| Synonyms: | HRSP12; P14.5; PSP; UK114; ribonuclease UK114; 14.5 kDa translational inhibitor protein; UK114 antigen homolog; heat-responsive protein 12; perchloric acid-soluble protein; translational inhibitor p14.5; translational inhibitor protein p14.5; reactive intermediate imine deaminase A homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtccttgatcagaagggtgatcagcaccgcgaaagccccaggggccattggaccctacagtcaagctgtattagtcgacaggaccatttacatttcaggacagataggcatggacccttcaagtggacagcttgtgtcaggaggggtagcagaagaagctaaacaagctcttaaaaacatgggtgaaattctgaaagctgcaggctgtgacttcactaacgtggtgaaaacaactgttcttctggctgacataaatgacttcaatactgtcaatgaaatctacaaacagtatttcaagagtaattttcctgctagagctgcttaccaagttgctgctttacccaaaggcagccgaattgaaattgaagcagtagctatccaaggaccactgacaacggcatcactataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 128 - mediator complex subunit 21 - M-phase phosphoprotein 6 - thymocyte nuclear protein 1 |