Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL21-chemokine (C-C motif) ligand 21 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL21-chemokine (C-C motif) ligand 21 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027918 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL21 |
| Origin species: | Human |
| Product name: | CCL21-chemokine (C-C motif) ligand 21 Gene |
| Size: | 2ug |
| Accessions: | BC027918 |
| Gene id: | 6366 |
| Gene description: | chemokine (C-C motif) ligand 21 |
| Synonyms: | 6Ckine; CKb9; ECL; SCYA21; SLC; TCA4; C-C motif chemokine 21; Efficient Chemoattractant for Lymphocytes; beta chemokine exodus-2; chemokine (C-C motif) ligand 21; secondary lymphoid tissue chemokine; small inducible cytokine subfamily A (Cys-Cys), member 21; C-C motif chemokine ligand 21 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcagtcactggctctgagcctccttatcctggttctggcctttggcatccccaggacccaaggcagtgatggaggggctcaggactgttgcctcaagtacagccaaaggaagattcccgccaaggttgtccgcagctaccggaagcaggaaccaagcttaggctgctccatcccagctatcctgttcttgccccgcaagcgctctcaggcagagctatgtgcagacccaaaggagctctgggtgcagcagctgatgcagcatctggacaagacaccatccccacagaaaccagcccagggctgcaggaaggacaggggggcctccaagactggcaagaaaggaaagggctccaaaggctgcaagaggactgagcggtcacagacccctaaagggccatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PYD and CARD domain containing - dynein, axonemal, light chain 1 - aarF domain containing kinase 5 - XTP3-transactivated protein A |