> >>FABP4-fatty acid binding protein 4, adipocyte Gene
FABP4-fatty acid binding protein 4, adipocyte Gene View larger

FABP4-fatty acid binding protein 4, adipocyte Gene

PTXBC003672

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FABP4-fatty acid binding protein 4, adipocyte Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FABP4-fatty acid binding protein 4, adipocyte Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003672
Product type: DNA & cDNA
Ncbi symbol: FABP4
Origin species: Human
Product name: FABP4-fatty acid binding protein 4, adipocyte Gene
Size: 2ug
Accessions: BC003672
Gene id: 2167
Gene description: fatty acid binding protein 4, adipocyte
Synonyms: A-FABP; AFABP; ALBP; HEL-S-104; aP2; fatty acid-binding protein, adipocyte; adipocyte fatty acid binding protein; adipocyte lipid-binding protein; adipocyte-type fatty acid-binding protein; epididymis secretory protein Li 104; fatty acid binding protein 4, adipocyte; fatty acid binding protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgtgatgcttttgtaggtacctggaaacttgtctccagtgaaaactttgatgattatatgaaagaagtaggagtgggctttgccaccaggaaagtggctggcatggccaaacctaacatgatcatcagtgtgaatggggatgtgatcaccattaaatctgaaagtacctttaaaaatactgagatttccttcatactgggccaggaatttgacgaagtcactgcagatgacaggaaagtcaagagcaccataaccttagatgggggtgtcctggtacatgtgcagaaatgggatggaaaatcaaccaccataaagagaaaacgagaggatgataaactggtggtggaatgcgtcatgaaaggcgtcacttccacgagagtttatgagagagcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aminoadipate-semialdehyde dehydrogenase
- NFKB inhibitor interacting Ras-like 1
- DNA-damage-inducible transcript 4-like
- synaptosomal-associated protein, 25kDa

Reviews

Buy FABP4-fatty acid binding protein 4, adipocyte Gene now

Add to cart