PTXBC012539
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012539 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MED31 |
| Origin species: | Human |
| Product name: | MED31-mediator complex subunit 31 Gene |
| Size: | 2ug |
| Accessions: | BC012539 |
| Gene id: | 51003 |
| Gene description: | mediator complex subunit 31 |
| Synonyms: | 3110004H13Rik; CGI-125; Soh1; mediator of RNA polymerase II transcription subunit 31; hSOH1; mediator complex subunit SOH1; mediator of RNA polymerase II transcription, subunit 31 homolog; mediator complex subunit 31 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgctgctgtcgctatggagacagatgatgctggaaatcgacttcggtttcagttggagttggaatttgtgcaatgtttagccaacccaaattaccttaattttcttgcccaaagaggttacttcaaagacaaagcttttgttaattatcttaaatacttgctttactggaaagacccagaatatgccaagtatctaaagtaccctcagtgtttacacatgttagagctgctccaatatgaacacttccgaaaggagctggtgaatgctcagtgtgcgaaatttattgatgaacagcagattctacattggcagcactattcccggaagcggatgcgccttcagcaagccttggcagagcagcaacagcaaaataacacatcgggaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - heat-responsive protein 12 - transmembrane protein 128 - mediator complex subunit 21 - M-phase phosphoprotein 6 |