PTXBC022554
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022554 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PEA15 |
| Origin species: | Human |
| Product name: | PEA15-phosphoprotein enriched in astrocytes 15 Gene |
| Size: | 2ug |
| Accessions: | BC022554 |
| Gene id: | 8682 |
| Gene description: | phosphoprotein enriched in astrocytes 15 |
| Synonyms: | HMAT1; HUMMAT1H; MAT1; MAT1H; PEA-15; PED; astrocytic phosphoprotein PEA-15; 15 kDa phosphoprotein enriched in astrocytes; homolog of mouse MAT-1 oncogene; mammary transforming gene 1, mouse, homolog of; phosphoprotein enriched in diabetes; phosphoprotein enriched in astrocytes 15 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgagtacgggaccctcctgcaagacctgaccaacaacatcacccttgaagatctagaacagctcaagtcggcctgcaaggaagacatccccagcgaaaagagtgaggagatcactactggcagtgcctggtttagcttcctggagagccacaacaagctggacaaagacaacctctcctacattgagcacatctttgagatctcccgccgtcctgacctactcactatggtggttgactacagaacccgtgtgctgaaaatctctgaggaggatgagctggacaccaagctaacccgtatccccagtgccaagaagtacaaagacattatccggcagccctctgaggaagagatcatcaaattggctcccccaccgaagaaggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (RNA) I polypeptide D, 16kDa - C-type lectin domain family 2, member B - chromosome 10 open reading frame 111 - similar to common salivary protein 1 |