Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H2BC-histone cluster 1, H2bc Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H2BC-histone cluster 1, H2bc Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009612 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H2BC |
| Origin species: | Human |
| Product name: | HIST1H2BC-histone cluster 1, H2bc Gene |
| Size: | 2ug |
| Accessions: | BC009612 |
| Gene id: | 8347 |
| Gene description: | histone cluster 1, H2bc |
| Synonyms: | H2B.1; H2B/l; H2BFL; dJ221C16.3; histone H2B type 1-C/E/F/G/I; H2B histone family, member L; histone 1, H2bc; histone H2B.1 A; histone H2B.l; histone cluster 1, H2bc; histone cluster 1 H2B family member c |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgagccagccaagtctgctcccgccccgaagaagggctccaagaaggcagtgaccaaagcgcagaagaaagatggcaagaagcgcaagcgcagccgcaaggagagttactctgtgtacgtgtacaaggtgctgaaacaggtccatcccgacactggcatctcttccaaggccatgggcatcatgaattctttcgttaacgacatatttgagcgcatcgcgggcgaggcttcccgcctggcgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgcttcccggagagctggccaagcacgccgtgtcggagggcaccaaggccgtcaccaagtacaccagctccaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SUB1 homolog (S. cerevisiae) - histone cluster 1, H2ag - mediator complex subunit 31 - heat-responsive protein 12 |