Login to display prices
Login to display prices
SUB1-SUB1 homolog (S. cerevisiae) Gene View larger

SUB1-SUB1 homolog (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SUB1-SUB1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SUB1-SUB1 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC009610
Ncbi symbol: SUB1
Product name: SUB1-SUB1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009610
Gene id: 10923
Gene description: SUB1 homolog (S. cerevisiae)
Synonyms: SUB1 homolog, transcriptional regulator; SUB1 homolog; P15; PC4; p14; activated RNA polymerase II transcriptional coactivator p15; activated RNA polymerase II transcription cofactor 4; positive cofactor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctaaatcaaaggaacttgtttcttcaggctcttctggcagtgattctgacagtgaggttgacaaaaagttaaagaggaaaaagcaagttgctccagaaaaacctgtaaagaaacaaaagacaggtgagacttcgagagccctgtcatcttctaaacagagcagcagcagcagagatgataacatgtttcagattgggaaaatgaggtacgttagtgttcgcgattttaaaggcaaagtgctaattgatattagagaatattggatggatcctgaaggtgaaatgaaaccaggaagaaaaggtatttctttaaatccagaacaatggagccagctgaaggaacagatttctgacattgatgatgcagtaagaaaactgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: