Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CDK2AP1-cyclin-dependent kinase 2 associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDK2AP1-cyclin-dependent kinase 2 associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034717 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDK2AP1 |
| Origin species: | Human |
| Product name: | CDK2AP1-cyclin-dependent kinase 2 associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC034717 |
| Gene id: | 8099 |
| Gene description: | cyclin-dependent kinase 2 associated protein 1 |
| Synonyms: | DOC1; DORC1; ST19; doc-1; p12DOC-1; cyclin-dependent kinase 2-associated protein 1; CDK2-associated protein 1; Deleted in oral cancer-1; deleted in oral cancer 1; cyclin dependent kinase 2 associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttacaaaccgaacttggccgcgcacatgcccgccgccgccctcaacgccgctgggagtgtccactcgccttccaccagcatggcaacgtcttcacagtaccgccagctgctcagtgactacgggccaccgtccctaggctacacccagggaactgggaacagccaggtgccccaaagcaaatacgcggagctgctggccatcattgaagagctggggaaggagatcagacccacgtacgcagggagcaagagtgccatggagaggctgaagcgcggcatcattcacgctagaggactggttcgggagtgcttggcagaaacggaacggaatgccagatcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thyroid hormone responsive (SPOT14 homolog, rat) - P antigen family, member 1 (prostate associated) - FXYD domain containing ion transport regulator 5 - linker for activation of T cells family, member 2 |