NDRG1-N-myc downstream regulated 1 Gene View larger

NDRG1-N-myc downstream regulated 1 Gene

PTXBC006260

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDRG1-N-myc downstream regulated 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDRG1-N-myc downstream regulated 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006260
Product type: DNA & cDNA
Ncbi symbol: NDRG1
Origin species: Human
Product name: NDRG1-N-myc downstream regulated 1 Gene
Size: 2ug
Accessions: BC006260
Gene id: 10397
Gene description: N-myc downstream regulated 1
Synonyms: protein NDRG1; CAP43; CMT4D; DRG-1; DRG1; GC4; HMSNL; NDR1; NMSL; PROXY1; RIT42; RTP; TARG1; TDD5; N-myc downstream-regulated gene 1 protein; differentiation-related gene 1 protein; nickel-specific induction protein Cap43; protein regulated by oxygen-1; reducing agents and tunicamycin-responsive protein; N-myc downstream regulated 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggactgtggcggcctcccgcagatctcccagccggccaagctcgctgaggccttcaagtacttcgtgcagggcatgggatacatgccctcggctagcatgacccgcctgatgcggtcccgcacagcctctggttccagcgtcacttctctggatggcacccgcagccgctcccacaccagcgagggcacccgaagccgctcccacaccagcgagggcacccgcagccgctcgcacaccagcgagggggcccacctggacatcacccccaactcgggtgctgctgggaacagcgccgggcccaagtccatggaggtctcctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - H2A histone family, member J
- ORM1-like 1 (S. cerevisiae)
- peripheral myelin protein 22
- serine/threonine kinase 32A

Buy NDRG1-N-myc downstream regulated 1 Gene now

Add to cart