Login to display prices
Login to display prices
APOL4-apolipoprotein L, 4 Gene View larger

APOL4-apolipoprotein L, 4 Gene

PTXBC006276

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOL4-apolipoprotein L, 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APOL4-apolipoprotein L, 4 Gene

Proteogenix catalog: PTXBC006276
Ncbi symbol: APOL4
Product name: APOL4-apolipoprotein L, 4 Gene
Size: 2ug
Accessions: BC006276
Gene id: 80832
Gene description: apolipoprotein L, 4
Synonyms: APOL-IV; APOLIV; apolipoprotein L4; apolipoprotein L, 4; apolipoprotein L-IV
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggatcctgggtgcagctcatcacaagcgtcgggacaagcggacttttccttggtgtgagagtgagggaagagggagctggaatgaggtgcagcaaaaccatccaggctggacagtggctggacagttccaagggtcctctgggcccatcccctccccctgtccctacagctggttacagcagctccttctgtgtccattatgtgaacctgctgcctggagttcttgttctttctgtgacctcccagtatccacatctcagcatggccctctgtcagctggctgctcatgactggccgaggttaagctgtgtttgtgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: