PCBD1-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha Gene View larger

PCBD1-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha Gene

PTXBC006324

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCBD1-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCBD1-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006324
Product type: DNA & cDNA
Ncbi symbol: PCBD1
Origin species: Human
Product name: PCBD1-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha Gene
Size: 2ug
Accessions: BC006324
Gene id: 5092
Gene description: pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha
Synonyms: DCOH; PCBD; PCD; PHS; pterin-4-alpha-carbinolamine dehydratase; 4-alpha-hydroxy-tetrahydropterin dehydratase; 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1); dimerizing cofactor for HNF1; phenylalanine hydroxylase-stimulating protein; pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha; pterin-4 alpha-carbinolamine dehydratase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctggcaaagcacacaggctgagcgctgaggagagggaccagctgctgccaaacctgagggctgtggggtggaatgagctggaaggccgtgatgccatcttcaagcagtttcatttcaaagacttcaacagggcctttgggttcatgacaagagtggccctgcaggctgagaaactggaccaccatcctgaatggtttaacgtgtacaacaaggtccacatcacgctgagcacccatgagtgtgccggcctttcagaacgggacataaacctggccagcttcatcgaacaagtagcagtgtccatgacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
- SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
- proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)

Buy PCBD1-pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha Gene now

Add to cart