SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene View larger

SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene

PTXBC005957

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005957
Product type: DNA & cDNA
Ncbi symbol: SLC25A17
Origin species: Human
Product name: SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene
Size: 2ug
Accessions: BC005957
Gene id: 10478
Gene description: solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Synonyms: peroxisomal membrane protein PMP34; solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17; solute carrier family 25 member 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccgtgctgtcctacgaaagcctggtccacgccgtggccggagccgtgggaagcgtgacagcaatgacagtgttttttcccctggatacagctagacttcgacttcaggttgatgagaaaagaaaatccaaaactacacacatggtgctcctggagatcattaaagaagaaggactcctggcaccatatcgagggtggtttccagtgatttccagtctctgctgctccaattttgtctatttctacacttttaatagcctcaaagcactctgggtcaaaggtcaacattctaccactggaaaagatctggtagttgggtttgttgcaggagtggttaatgtgttgctaacaactccactctgggtggtaaacaccagactgaagcttcaaggagcaaaatttaggaatgaagacattgtaccaacaaactacaaaggtatcattgatgcttttcatcagatcattcgcgatgaaggaatctcggctttatggaatggcacatttccctcattgctgttggtcttcaatcctgccatccagttcatgttttatgaaggtttaaaacggcagcttttaaagaaacggatgaagctttcttccttggatgtgttcatcattggtgcagtagccaaagcgattgccaccacggtgacctatcccctgcagacggtacagtcaattctgaggtttgggcgtcatagactaaacccagaaaacagaacattgggaagtcttcggaatattctctatcttcttcaccaacgagtaagacgttttggaataatgggactctacaaaggccttgaagccaaactgctgcagacagtcctcactgctgctctcatgttccttgtttatgagaaactgacagctgccaccttcacagttatggggctgaagcgtgcacaccaacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1
- proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)

Buy SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene now

Add to cart