Login to display prices
Login to display prices
SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene View larger

SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene

PTXBC005957

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A17-solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein, 34kDa), member 17 Gene

Ncbi symbol: SLC25A17
Size: 2ug
Accessions: BC005957
Gene id: 10478
Gene description: solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Synonyms: peroxisomal membrane protein PMP34; solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17; solute carrier family 25 member 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccgtgctgtcctacgaaagcctggtccacgccgtggccggagccgtgggaagcgtgacagcaatgacagtgttttttcccctggatacagctagacttcgacttcaggttgatgagaaaagaaaatccaaaactacacacatggtgctcctggagatcattaaagaagaaggactcctggcaccatatcgagggtggtttccagtgatttccagtctctgctgctccaattttgtctatttctacacttttaatagcctcaaagcactctgggtcaaaggtcaacattctaccactggaaaagatctggtagttgggtttgttgcaggagtggttaatgtgttgctaacaactccactctgggtggtaaacaccagactgaagcttcaaggagcaaaatttaggaatgaagacattgtaccaacaaactacaaaggtatcattgatgcttttcatcagatcattcgcgatgaaggaatctcggctttatggaatggcacatttccctcattgctgttggtcttcaatcctgccatccagttcatgttttatgaaggtttaaaacggcagcttttaaagaaacggatgaagctttcttccttggatgtgttcatcattggtgcagtagccaaagcgattgccaccacggtgacctatcccctgcagacggtacagtcaattctgaggtttgggcgtcatagactaaacccagaaaacagaacattgggaagtcttcggaatattctctatcttcttcaccaacgagtaagacgttttggaataatgggactctacaaaggccttgaagccaaactgctgcagacagtcctcactgctgctctcatgttccttgtttatgagaaactgacagctgccaccttcacagttatggggctgaagcgtgcacaccaacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: