Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DPY19L3-dpy-19-like 3 (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DPY19L3-dpy-19-like 3 (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029162 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DPY19L3 |
| Origin species: | Human |
| Product name: | DPY19L3-dpy-19-like 3 (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC029162 |
| Gene id: | 147991 |
| Gene description: | dpy-19-like 3 (C. elegans) |
| Synonyms: | dpy-19-like 3; dpy-19-like protein 3; protein dpy-19 homolog 3; dpy-19 like 3 (C. elegans) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgtccatccggcaaagaagagaaataagagccacagaagtttctgaagactttccagcccaagaagaaaatgtgaagttggaaaataaattgccatctggttgtaccagtagaagattatggaagattttgtcattgacaattggtggaaccattgccctttgcattggacttcttacatctgtctaccttgccacgttacatgaaaatgatttatggttttctaatattaaggtatggagtttctttgaccattgtatcattcactcagtgggatctccagtagtaagccatgtggatgaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-myc downstream regulated 1 - H2A histone family, member J - ORM1-like 1 (S. cerevisiae) - peripheral myelin protein 22 |