DPY19L3-dpy-19-like 3 (C. elegans) Gene View larger

DPY19L3-dpy-19-like 3 (C. elegans) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DPY19L3-dpy-19-like 3 (C. elegans) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DPY19L3-dpy-19-like 3 (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029162
Product type: DNA & cDNA
Ncbi symbol: DPY19L3
Origin species: Human
Product name: DPY19L3-dpy-19-like 3 (C. elegans) Gene
Size: 2ug
Accessions: BC029162
Gene id: 147991
Gene description: dpy-19-like 3 (C. elegans)
Synonyms: dpy-19-like 3; dpy-19-like protein 3; protein dpy-19 homolog 3; dpy-19 like 3 (C. elegans)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtccatccggcaaagaagagaaataagagccacagaagtttctgaagactttccagcccaagaagaaaatgtgaagttggaaaataaattgccatctggttgtaccagtagaagattatggaagattttgtcattgacaattggtggaaccattgccctttgcattggacttcttacatctgtctaccttgccacgttacatgaaaatgatttatggttttctaatattaaggtatggagtttctttgaccattgtatcattcactcagtgggatctccagtagtaagccatgtggatgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-myc downstream regulated 1
- H2A histone family, member J
- ORM1-like 1 (S. cerevisiae)
- peripheral myelin protein 22

Buy DPY19L3-dpy-19-like 3 (C. elegans) Gene now

Add to cart