INVS-inversin Gene View larger

INVS-inversin Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INVS-inversin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about INVS-inversin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006370
Product type: DNA & cDNA
Ncbi symbol: INVS
Origin species: Human
Product name: INVS-inversin Gene
Size: 2ug
Accessions: BC006370
Gene id: 27130
Gene description: inversin
Synonyms: INV; NPH2; NPHP2; inversin; inversion of embryo turning homolog; inversion of embryonic turning; nephrocystin-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaagtcagagaacctgctgtttgctggttcatcattagcatcacaagtccatgctgctgccgttaatggagataagggtgctctacagaggctcatcgtaggaaactctgctcttaaagacaaagaagatcagtttgggagaacaccacttatgtattgcgtgttggctgacagattggattgtgcagatgctcttctgaaggcaggagcagatgtgaataaaactgaccatagccagagaacagccctccatcttgcagcccagaaggcattgagaacaatcagcacaggcaggatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melan-A
- stratifin
- stomatin
- cyclin H

Buy INVS-inversin Gene now

Add to cart