Login to display prices
Login to display prices
INVS-inversin Gene View larger

INVS-inversin Gene

PTXBC006370

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of INVS-inversin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about INVS-inversin Gene

Proteogenix catalog: PTXBC006370
Ncbi symbol: INVS
Product name: INVS-inversin Gene
Size: 2ug
Accessions: BC006370
Gene id: 27130
Gene description: inversin
Synonyms: INV; NPH2; NPHP2; inversin; inversion of embryo turning homolog; inversion of embryonic turning; nephrocystin-2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaagtcagagaacctgctgtttgctggttcatcattagcatcacaagtccatgctgctgccgttaatggagataagggtgctctacagaggctcatcgtaggaaactctgctcttaaagacaaagaagatcagtttgggagaacaccacttatgtattgcgtgttggctgacagattggattgtgcagatgctcttctgaaggcaggagcagatgtgaataaaactgaccatagccagagaacagccctccatcttgcagcccagaaggcattgagaacaatcagcacaggcaggatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: