SFN-stratifin Gene View larger

SFN-stratifin Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFN-stratifin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SFN-stratifin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001550
Product type: DNA & cDNA
Ncbi symbol: SFN
Origin species: Human
Product name: SFN-stratifin Gene
Size: 2ug
Accessions: BC001550
Gene id: 2810
Gene description: stratifin
Synonyms: YWHAS; 14-3-3 protein sigma; 14-3-3 sigma; epithelial cell marker protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagagccagtctgatccagaaggccaagctggcagagcaggccgaacgctatgaggacatggcagccttcatgaaaggcgccgtggagaagggcgaggagctctcctgcgaagagcgaaacctgctctcagtagcctataagaacgtggtgggcggccagagggctgcctggagggtgctgtccagtattgagcagaaaagcaacgaggagggctcggaggagaaggggcccgaggtgcgtgagtaccgggtcttctacctgaagatgaagggtgactactaccgctacctggccgaggtggccaccggtgacgacaagaagcgcatcattgactcagcccggtcagcctaccaggaggccatggacatcagcaagaaggagatgccgcccaccaaccccatccgcctgggcctggccctgaacttttccgtcttccactacgagatcgccaacagccccgaggaggccatctctctggccaagaccactttcgacgaggccatggctgatctgcacaccctcagcgaggactcctacaaagacagcaccctcatcatgcagctgctgcgagacaacctgacactgtggacggccgacaacgccggggaagaggggggcgaggctccccaggagccccagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - stomatin
- cyclin H
- netrin 4
- cyclin I

Buy SFN-stratifin Gene now

Add to cart