Login to display prices
Login to display prices
STOM-stomatin Gene View larger

STOM-stomatin Gene

PTXBC010703

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STOM-stomatin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STOM-stomatin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010703
Product type: DNA & cDNA
Ncbi symbol: STOM
Origin species: Human
Product name: STOM-stomatin Gene
Size: 2ug
Accessions: BC010703
Gene id: 2040
Gene description: stomatin
Synonyms: BND7; EPB7; EPB72; erythrocyte band 7 integral membrane protein; erythrocyte membrane protein band 7.2 (stomatin); erythrocyte surface protein band 7.2; protein 7.2b; stomatin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgagaagcggcacacacgggactccgaagcccagcggctccccgactccttcaaggacagccccagtaagggccttggaccttgcggatggattttggtggcgttctcattcttattcaccgttataactttcccaatctcaatatggatgtgcataaagattataaaagagtatgaaagagccatcatctttagattgggtcgcattttacaaggaggagccaaaggacctggtttgttttttattctgccatgcactgacagcttcatcaaagtggacatgagaactatttcatttgatattcctcctcaggagatcctcacaaaggattcagtgacaattagcgtggatggtgtggtctattaccgcgttcagaatgcaaccctggctgtggcaaatatcaccaacgctgactcagcaacccgtcttttggcacaaactactctgaggaatgttctgggcaccaagaatctttctcagatcctctctgacagagaagaaattgcacacaacatgcagtctactctggatgatgccactgatgcctggggaataaaggtggagcgtgtggaaattaaggatgtgaaactacctgtgcagctccagagagctatggctgcagaagcagaagcgtcccgcgaggcccgcgccaaggttattgcagccgaaggagaaatgaatgcatccagggctctgaaagaagcctccatggtcatcactgaatatcctgcagcccttcagctccgatacctgcagacactgaccaccattgctgctgagaaaaactcaacaattgtcttccctctgcccatagatatgctgcaaggaatcataggggcaaaacacagccatctaggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cyclin H
- netrin 4
- cyclin I
- FRY-like