MLANA-melan-A Gene View larger

MLANA-melan-A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MLANA-melan-A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MLANA-melan-A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014423
Product type: DNA & cDNA
Ncbi symbol: MLANA
Origin species: Human
Product name: MLANA-melan-A Gene
Size: 2ug
Accessions: BC014423
Gene id: 2315
Gene description: melan-A
Synonyms: MART-1; MART1; melanoma antigen recognized by T-cells 1; antigen LB39-AA; antigen SK29-AA; protein Melan-A; melan-A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaagagaagatgctcacttcatctatggttaccccaagaaggggcacggccactcttacaccacggctgaagaggccgctgggatcggcatcctgacagtgatcctgggagtcttactgctcatcggctgttggtattgtagaagacgaaatggatacagagccttgatggataaaagtcttcatgttggcactcaatgtgccttaacaagaagatgcccacaagaagggtttgatcatcgggacagcaaagtgtctcttcaagagaaaaactgtgaacctgtggttcccaatgctccacctgcttatgagaaactctctgcagaacagtcaccaccaccttattcaccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - stratifin
- stomatin
- cyclin H
- netrin 4

Buy MLANA-melan-A Gene now

Add to cart