Login to display prices
Login to display prices
ENY2-enhancer of yellow 2 homolog (Drosophila) Gene View larger

ENY2-enhancer of yellow 2 homolog (Drosophila) Gene

PTXBC007870

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ENY2-enhancer of yellow 2 homolog (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ENY2-enhancer of yellow 2 homolog (Drosophila) Gene

Proteogenix catalog: PTXBC007870
Ncbi symbol: ENY2
Product name: ENY2-enhancer of yellow 2 homolog (Drosophila) Gene
Size: 2ug
Accessions: BC007870
Gene id: 56943
Gene description: enhancer of yellow 2 homolog (Drosophila)
Synonyms: ENY2, transcription and export complex 2 subunit; transcription and mRNA export factor ENY2; DC6; Sus1; enhancer of yellow 2 homolog; enhancer of yellow 2 transcription factor homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggttagcaagatgaacaaagatgcgcagatgagagcagcgattaaccaaaagttgatagaaactggagaaagagaacgcctcaaagagttgctgagagctaaattaattgaatgtggctggaaggatcagttgaaggcacactgtaaagaggtaattaaagaaaaaggactagaacacgttactgttgatgacttggtggctgaaatcactccaaaaggcagagccctggtacctgacagtgtaaagaaggagctcctacaaagaataagaacattccttgctcagcatgccagcctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: