Login to display prices
Login to display prices
CCL19-chemokine (C-C motif) ligand 19 Gene View larger

CCL19-chemokine (C-C motif) ligand 19 Gene

PTXBC027968

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCL19-chemokine (C-C motif) ligand 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCL19-chemokine (C-C motif) ligand 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027968
Product type: DNA & cDNA
Ncbi symbol: CCL19
Origin species: Human
Product name: CCL19-chemokine (C-C motif) ligand 19 Gene
Size: 2ug
Accessions: BC027968
Gene id: 6363
Gene description: chemokine (C-C motif) ligand 19
Synonyms: CKb11; ELC; MIP-3b; MIP3B; SCYA19; C-C motif chemokine 19; CC chemokine ligand 19; CK beta-11; EBI1-ligand chemokine; MIP-3-beta; beta chemokine exodus-3; chemokine (C-C motif) ligand 19; epstein-Barr virus-induced molecule 1 ligand chemokine; exodus-3; macrophage inflammatory protein 3-beta; small inducible cytokine subfamily A (Cys-Cys), member 19; small-inducible cytokine A19; C-C motif chemokine ligand 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgctactggccctcagcctgctggttctctggacttccccagccccaactctgagtggcaccaatgatgctgaagactgctgcctgtctgtgacccagaaacccatccctgggtacatcgtgaggaacttccactaccttctcatcaaggatggctgcagggtgcctgctgtagtgttcaccacactgaggggccgccagctctgtgcacccccagaccagccctgggtagaacgcatcatccagagactgcagaggacctcagccaagatgaagcgccgcagcagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - egl nine homolog 2 (C. elegans)
- egl nine homolog 1 (C. elegans)
- cytochrome c oxidase subunit Vb
- chemokine (C-C motif) ligand 21