Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL19-chemokine (C-C motif) ligand 19 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL19-chemokine (C-C motif) ligand 19 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027968 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL19 |
| Origin species: | Human |
| Product name: | CCL19-chemokine (C-C motif) ligand 19 Gene |
| Size: | 2ug |
| Accessions: | BC027968 |
| Gene id: | 6363 |
| Gene description: | chemokine (C-C motif) ligand 19 |
| Synonyms: | CKb11; ELC; MIP-3b; MIP3B; SCYA19; C-C motif chemokine 19; CC chemokine ligand 19; CK beta-11; EBI1-ligand chemokine; MIP-3-beta; beta chemokine exodus-3; chemokine (C-C motif) ligand 19; epstein-Barr virus-induced molecule 1 ligand chemokine; exodus-3; macrophage inflammatory protein 3-beta; small inducible cytokine subfamily A (Cys-Cys), member 19; small-inducible cytokine A19; C-C motif chemokine ligand 19 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgctactggccctcagcctgctggttctctggacttccccagccccaactctgagtggcaccaatgatgctgaagactgctgcctgtctgtgacccagaaacccatccctgggtacatcgtgaggaacttccactaccttctcatcaaggatggctgcagggtgcctgctgtagtgttcaccacactgaggggccgccagctctgtgcacccccagaccagccctgggtagaacgcatcatccagagactgcagaggacctcagccaagatgaagcgccgcagcagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - egl nine homolog 2 (C. elegans) - egl nine homolog 1 (C. elegans) - cytochrome c oxidase subunit Vb - chemokine (C-C motif) ligand 21 |