Cart 29 Product Products 5 007,55 € (empty)
-
1 x BXDC1-brix...121,50 € -
1 x NAT1-N-ace...121,50 € -
-
1 x C15orf50-c...113,40 € -
1 x ZNF436-zin...121,50 € -
1 x IGKC-immun...113,40 € -
-
1 x ASB6-ankyr...121,50 € -
-
1 x C1QTNF3-C1...121,50 € -
-
1 x TP53-tumor...121,50 € -
1 x CSNK1D-cas...121,50 € -
-
-
1 x CNIH3-corn...113,40 € -
1 x TUBAL3-tub...121,50 € -
1 x KIAA0999-K...121,50 € -
1 x RPS27L-rib...113,40 € -
-
-
1 x HIST2H2AC-...113,40 € -
1 x CLEC11A-C-...121,50 € -
-
-
-
1 x GRN-granul...121,50 € -
1 x B4GALT7-xy...121,50 € -
No products
To be determined Shipping
5 007,55 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 007,55 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 007,55 €
Data sheet of EGLN1-egl nine homolog 1 (C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EGLN1-egl nine homolog 1 (C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005369 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EGLN1 |
| Origin species: | Human |
| Product name: | EGLN1-egl nine homolog 1 (C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC005369 |
| Gene id: | 54583 |
| Gene description: | egl nine homolog 1 (C. elegans) |
| Synonyms: | C1orf12; ECYT3; HALAH; HIF-PH2; HIFPH2; HPH-2; HPH2; PHD2; SM20; ZMYND6; egl nine homolog 1; HIF-prolyl hydroxylase 2; egl nine-like protein 1; hypoxia-inducible factor prolyl hydroxylase 2; prolyl hydroxylase domain-containing protein 2; zinc finger MYND domain-containing protein 6; egl-9 family hypoxia inducible factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttgcttgttatccgggcaatggaacgggttatgtacgtcatgttgataatccaaatggagatggaagatgtgtgacatgtatatattatcttaataaagactgggatgccaaggtaagtggaggtatacttcgaatttttccagaaggcaaagcccagtttgctgacattgaacccaaatttgatagactgctgtttttctggtctgaccgtcgcaaccctcatgaagtacaaccagcatatgctacaaggtacgcaataactgtttggtattttgatgcagatgagagagcacgagctaaagtaaaatatctaacaggtgaaaaaggtgtgagggttgaactcaataaaccttcagattcggtcggtaaagacgtcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome c oxidase subunit Vb - chemokine (C-C motif) ligand 21 - PYD and CARD domain containing - dynein, axonemal, light chain 1 |