Login to display prices
Login to display prices
EGLN2-egl nine homolog 2 (C. elegans) Gene View larger

EGLN2-egl nine homolog 2 (C. elegans) Gene

PTXBC001723

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EGLN2-egl nine homolog 2 (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EGLN2-egl nine homolog 2 (C. elegans) Gene

Proteogenix catalog: PTXBC001723
Ncbi symbol: EGLN2
Product name: EGLN2-egl nine homolog 2 (C. elegans) Gene
Size: 2ug
Accessions: BC001723
Gene id: 112398
Gene description: egl nine homolog 2 (C. elegans)
Synonyms: EIT6; HIF-PH1; HIFPH1; HPH-1; HPH-3; PHD1; egl nine homolog 2; HIF-prolyl hydroxylase 1; estrogen-induced tag 6; hypoxia-inducible factor prolyl hydroxylase 1; prolyl hydroxylase domain-containing protein 1; egl-9 family hypoxia inducible factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggcgtgttacccaggcaacgggctcgggtacgtaaggcacgttgacaatccccacggcgatgggcgctgcatcacctgtatctattacctgaatcagaactgggacgttaaggtgcatggcggcctgctgcagatcttccctgagggccggcccgtggtagccaacatcgagccactctttgaccggttgctcattttctggtctgaccggcggaacccccacgaggtgaagccagcctatgccaccaggtacgccatcactgtctggtattttgatgccaaggagcgggcagcagccaaagacaagtatcagctagcatcaggacagaaaggtgtccaagtacctgtatcacagccgcctacgcccacctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: