IHPK2-inositol hexaphosphate kinase 2 Gene View larger

IHPK2-inositol hexaphosphate kinase 2 Gene

PTXBC004469

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IHPK2-inositol hexaphosphate kinase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IHPK2-inositol hexaphosphate kinase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004469
Product type: DNA & cDNA
Ncbi symbol: IHPK2
Origin species: Human
Product name: IHPK2-inositol hexaphosphate kinase 2 Gene
Size: 2ug
Accessions: BC004469
Gene id: 51447
Gene description: inositol hexaphosphate kinase 2
Synonyms: IHPK2; PIUS; inositol hexakisphosphate kinase 2; ATP:1D-myo-inositol-hexakisphosphate phosphotransferase; inositol hexaphosphate kinase 2; insp6 kinase 2; pi uptake stimulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcccagccttcagggccatggatgtggagccccgcgccaaaggcgtccttctggagccctttgtccaccaggtcggggggcactcatgcgtgctccgcttcaatgagacaaccctgtgcaagcccctggtcccaagggaacatcagttctacgagaccctccctgctgagatgcgcaaattcactccccagtacaaaggacaaagccaaaggccccttgttagctggccatccctgccccattttttcccctggtcctttcccctgtggccacagggaagtgtggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-C motif) ligand 19
- egl nine homolog 2 (C. elegans)
- egl nine homolog 1 (C. elegans)
- cytochrome c oxidase subunit Vb

Buy IHPK2-inositol hexaphosphate kinase 2 Gene now

Add to cart