LOC100132167-similar to hCG1993567 Gene View larger

LOC100132167-similar to hCG1993567 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC100132167-similar to hCG1993567 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC100132167-similar to hCG1993567 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006438
Product type: DNA & cDNA
Ncbi symbol: LOC100132167
Origin species: Human
Product name: LOC100132167-similar to hCG1993567 Gene
Size: 2ug
Accessions: BC006438
Gene id: 100132167
Gene description: similar to hCG1993567
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgttactatgatcactattttacagctacccaaggtgcgaaaaagaaaaaaggccaaagggaagaaggtggtgctaacccttgcggtcttgaaaaagcaggagaccatgaaagtggtgaatcttccatttgagaaatttggcactggacaggacattttggcattggacagaacatccagcccaaaagggacctcacttgctttgtcaaatggccccattatactaggttgcagcagcagagagccatcctctataagcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dpy-19-like 3 (C. elegans)
- N-myc downstream regulated 1
- H2A histone family, member J
- ORM1-like 1 (S. cerevisiae)

Buy LOC100132167-similar to hCG1993567 Gene now

Add to cart