HIATL2-hippocampus abundant transcript-like 2 Gene View larger

HIATL2-hippocampus abundant transcript-like 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIATL2-hippocampus abundant transcript-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HIATL2-hippocampus abundant transcript-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005058
Product type: DNA & cDNA
Ncbi symbol: HIATL2
Origin species: Human
Product name: HIATL2-hippocampus abundant transcript-like 2 Gene
Size: 2ug
Accessions: BC005058
Gene id: 84278
Gene description: hippocampus abundant transcript-like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgactgttctacatgaaacattttctcaacacacattcctcatgaatggtctcattcaaggtgtaaagggcctgctctcttttttgagtgccccactcattggtgccctgtctgatgtgtgggggaggaagccctttctcctcggcactgtattctttacctgcttcccaatcccactgatgaggatcagcccatgccgggtgtggtggcgtgcacctgtagtcccagctacctgtggcaggagaatggcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fatty acid binding protein 4, adipocyte
- aminoadipate-semialdehyde dehydrogenase
- NFKB inhibitor interacting Ras-like 1
- DNA-damage-inducible transcript 4-like

Buy HIATL2-hippocampus abundant transcript-like 2 Gene now

Add to cart