IQCF1-IQ motif containing F1 Gene View larger

IQCF1-IQ motif containing F1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IQCF1-IQ motif containing F1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IQCF1-IQ motif containing F1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034228
Product type: DNA & cDNA
Ncbi symbol: IQCF1
Origin species: Human
Product name: IQCF1-IQ motif containing F1 Gene
Size: 2ug
Accessions: BC034228
Gene id: 132141
Gene description: IQ motif containing F1
Synonyms: IQ domain-containing protein F1; IQ motif containing F1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagaagcagccccaaaagacgaaggaaccctcaaaagaagatgagcctcagcagaaggagatgccaacccatttgtccttaggagcagagtcaaaggcagaggctaaaactccagttctggttgagacacagacagtggacaatgccaatgagaaatcagaaaaagtgtgtcagtggaatatggtcatcgtcagcatggattggaagtccttggagtctgaagacttgaggaatttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcription factor EC
- B-cell CLL/lymphoma 7B
- Ras-like without CAAX 2
- ring finger protein 32

Buy IQCF1-IQ motif containing F1 Gene now

Add to cart