Login to display prices
Login to display prices
BCL7B-B-cell CLL/lymphoma 7B Gene View larger

BCL7B-B-cell CLL/lymphoma 7B Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BCL7B-B-cell CLL/lymphoma 7B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BCL7B-B-cell CLL/lymphoma 7B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000956
Product type: DNA & cDNA
Ncbi symbol: BCL7B
Origin species: Human
Product name: BCL7B-B-cell CLL/lymphoma 7B Gene
Size: 2ug
Accessions: BC000956
Gene id: 9275
Gene description: B-cell CLL/lymphoma 7B
Synonyms: B-cell CLL/lymphoma 7 protein family member B; B-cell CLL/lymphoma 7B; BCL tumor suppressor 7B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggccggtcggtccgggcggagacccgcagccgggccaaggacgacatcaagaaggtgatggcggccatcgagaaagtgcggaaatgggagaagaagtgggtgactgtgggtgacacgtccctgaggatatttaagtgggttcctgtgacagacagcaaggagaaagaaaagtcaaaatcgaacagttcagcagcccgagaacctaatggctttccttctgatgcctcagccaattcctctctccttcttgaattccaggacgaaaacagcaaccagagttccgtgtctgacgtctatcagcttaaggtggacagcagcaccaactcaagccccagcccccagcagagtgagtccctgagcccagcacacacctccgacttccgcacggatgactcccagcccccaacgctgggccaggagatcctggaggagccctccctgccctcctcggaagttgctgatgaacctcctaccctcaccaaggaagaaccagttccactagagacacaggtcgttgaggaagaggaagactcaggtgccccgcccctgaagcgcttctgtgtggaccaacccacagtgccgcagacggcgtcagaaagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Ras-like without CAAX 2
- ring finger protein 32
- zinc finger protein 99
- ring finger protein 32