Cart 1 Product Products 146,21 € (empty)
No products
To be determined Shipping
146,21 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 146,21 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 146,21 €
Data sheet of RNF32-ring finger protein 32 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNF32-ring finger protein 32 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028120 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNF32 |
| Origin species: | Human |
| Product name: | RNF32-ring finger protein 32 Gene |
| Size: | 2ug |
| Accessions: | BC028120 |
| Gene id: | 140545 |
| Gene description: | ring finger protein 32 |
| Synonyms: | FKSG33; HSD15; LMBR2; RING finger protein 32 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttaaaaaataagggtcactcatctaagaaagataacttggcagtcaatgcagttgctttacaagatcacattttacatgatcttcaacttcgaaatctttcagttgcagatcattctaagacacaagtacaaaagaaagagaacaaatctctaaaaagagatacaaaggcaataatagatactggacttaaaaaaactacacagtgccccaaactagaagactcagaaaaagaatatgttcttgatcccaaaccgccgccgttgactttggcacagaagttgggcctcattgggcctccaccacctccactgtcatcagatgaatgggagaaggtgaaacagcgctctctcctgcaaggggactccgtgcaaccatgccccatctgtaaagaagaattcgagcttcgtcctcaggtgctgctttcatgctcccatgtgttccacaaagcatgtcttcaggcttttgaaaagttcacaaataagaaaacctgtcctctctgtagaaagaaccagtatcaaacccgagtgatacacgatggggcccgcctgttcagaatcaagtgtgtgaccagaatccaagcctactggagaggatgtgttgttagaaagtggtacagaaacctgaggaaaacagtacctcccacagatgccaagttaagaaaaaattctttgaaaaaaagttcacagaaatcagccaccgcatcctgtgctcatacaacaccaacattgaagagctctttgcagaaatcgatcagtgcttggccataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - X-box binding protein 1 - kinesin family member 6 - RAD1 homolog (S. pombe) - ermin, ERM-like protein |