Login to display prices
Login to display prices
RNF32-ring finger protein 32 Gene View larger

RNF32-ring finger protein 32 Gene

PTXBC028120

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF32-ring finger protein 32 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF32-ring finger protein 32 Gene

Proteogenix catalog: PTXBC028120
Ncbi symbol: RNF32
Product name: RNF32-ring finger protein 32 Gene
Size: 2ug
Accessions: BC028120
Gene id: 140545
Gene description: ring finger protein 32
Synonyms: FKSG33; HSD15; LMBR2; RING finger protein 32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttaaaaaataagggtcactcatctaagaaagataacttggcagtcaatgcagttgctttacaagatcacattttacatgatcttcaacttcgaaatctttcagttgcagatcattctaagacacaagtacaaaagaaagagaacaaatctctaaaaagagatacaaaggcaataatagatactggacttaaaaaaactacacagtgccccaaactagaagactcagaaaaagaatatgttcttgatcccaaaccgccgccgttgactttggcacagaagttgggcctcattgggcctccaccacctccactgtcatcagatgaatgggagaaggtgaaacagcgctctctcctgcaaggggactccgtgcaaccatgccccatctgtaaagaagaattcgagcttcgtcctcaggtgctgctttcatgctcccatgtgttccacaaagcatgtcttcaggcttttgaaaagttcacaaataagaaaacctgtcctctctgtagaaagaaccagtatcaaacccgagtgatacacgatggggcccgcctgttcagaatcaagtgtgtgaccagaatccaagcctactggagaggatgtgttgttagaaagtggtacagaaacctgaggaaaacagtacctcccacagatgccaagttaagaaaaaattctttgaaaaaaagttcacagaaatcagccaccgcatcctgtgctcatacaacaccaacattgaagagctctttgcagaaatcgatcagtgcttggccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: