Login to display prices
Login to display prices
RAD1-RAD1 homolog (S. pombe) Gene View larger

RAD1-RAD1 homolog (S. pombe) Gene

PTXBC006837

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAD1-RAD1 homolog (S. pombe) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAD1-RAD1 homolog (S. pombe) Gene

Proteogenix catalog: PTXBC006837
Ncbi symbol: RAD1
Product name: RAD1-RAD1 homolog (S. pombe) Gene
Size: 2ug
Accessions: BC006837
Gene id: 5810
Gene description: RAD1 homolog (S. pombe)
Synonyms: RAD1 checkpoint DNA exonuclease; rad1-like DNA damage checkpoint protein; exonuclease homolog RAD1; RAD1 homolog; RAD1 checkpoint clamp component; DNA repair exonuclease rad1 homolog; cell cycle checkpoint protein RAD1; HRAD1; REC1; DNA repair exonuclease REC1; cell cycle checkpoint protein Hrad1; checkpoint control protein HRAD1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccttctgacccaacagatccaagacgaggatgatcagtacagccttgtggccagccttgacaacgttaggaatctctccactatcttgaaagctattcatttccgagaacatgccacgtgtttcgcaactaaaaatggtatcaaagtaacagtggaaaatgcaaagtgtgtgcaagcaaatgcttttattcaggctggaatatttcaggagtttaaagttcaggaagagtctgttacttttcgaattaatttaactgtccttttagactgtttatctatttttggatcaagtcctatgccagggactttaactgcacttcgaatgtgttaccaaggttatggttaccctttgatgctgttcctggaagaaggaggagtggtgacagtctgcaaaatcaatacacaggaacctgaggagaccctggactttgatttctgcagcaccaatgttattaataaaattattctgcagtcagaggggctccgtgaagcattttctgaattggatatgacgagtgaagtcctacaaattaccatgtctcctgacaagccttatttcaggttatctacttttggaaatgcaggaagttcccaccttgactatcccaaagattctgatttgatggaagcatttcattgtaatcagacccaagtcaacagatacaagatttccttactgaaaccctctacaaaggcattagtcctatcttgtaaggtatctattcggacagataacagaggcttcctttcattacagtatatgattagaaatgaagatggacaaatatgttttgtggaatattactgctgccctgatgaagaagttcctgaatctgagtcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: