Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RAD1-RAD1 homolog (S. pombe) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAD1-RAD1 homolog (S. pombe) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006837 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAD1 |
| Origin species: | Human |
| Product name: | RAD1-RAD1 homolog (S. pombe) Gene |
| Size: | 2ug |
| Accessions: | BC006837 |
| Gene id: | 5810 |
| Gene description: | RAD1 homolog (S. pombe) |
| Synonyms: | RAD1 checkpoint DNA exonuclease; rad1-like DNA damage checkpoint protein; exonuclease homolog RAD1; RAD1 homolog; RAD1 checkpoint clamp component; DNA repair exonuclease rad1 homolog; cell cycle checkpoint protein RAD1; HRAD1; REC1; DNA repair exonuclease REC1; cell cycle checkpoint protein Hrad1; checkpoint control protein HRAD1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccccttctgacccaacagatccaagacgaggatgatcagtacagccttgtggccagccttgacaacgttaggaatctctccactatcttgaaagctattcatttccgagaacatgccacgtgtttcgcaactaaaaatggtatcaaagtaacagtggaaaatgcaaagtgtgtgcaagcaaatgcttttattcaggctggaatatttcaggagtttaaagttcaggaagagtctgttacttttcgaattaatttaactgtccttttagactgtttatctatttttggatcaagtcctatgccagggactttaactgcacttcgaatgtgttaccaaggttatggttaccctttgatgctgttcctggaagaaggaggagtggtgacagtctgcaaaatcaatacacaggaacctgaggagaccctggactttgatttctgcagcaccaatgttattaataaaattattctgcagtcagaggggctccgtgaagcattttctgaattggatatgacgagtgaagtcctacaaattaccatgtctcctgacaagccttatttcaggttatctacttttggaaatgcaggaagttcccaccttgactatcccaaagattctgatttgatggaagcatttcattgtaatcagacccaagtcaacagatacaagatttccttactgaaaccctctacaaaggcattagtcctatcttgtaaggtatctattcggacagataacagaggcttcctttcattacagtatatgattagaaatgaagatggacaaatatgttttgtggaatattactgctgccctgatgaagaagttcctgaatctgagtcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ermin, ERM-like protein - biliverdin reductase A - uridine phosphorylase 2 - adenosine A3 receptor |