ERMN-ermin, ERM-like protein Gene View larger

ERMN-ermin, ERM-like protein Gene

PTXBC026345

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERMN-ermin, ERM-like protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERMN-ermin, ERM-like protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026345
Product type: DNA & cDNA
Ncbi symbol: ERMN
Origin species: Human
Product name: ERMN-ermin, ERM-like protein Gene
Size: 2ug
Accessions: BC026345
Gene id: 57471
Gene description: ermin, ERM-like protein
Synonyms: KIAA1189; ermin; ermin, ERM-like protein; juxtanodin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagatgttccggctacatttacccaggctgagtgtaatggggataaaccacctgaaaacggtcaacaaacaatcactaaaatcagtgaggaattgactgatgtggacagccccctgccacactacagggtagaacccagtctggaaggtgcactcaccaaaggaagtcaggaggaaagaagaaaattacaagggaacatgctgctcaactcatccatggaggacaaaatgctaaaagaaaacccagaagagaaactctttattgttcataaggctatcacagatctttctctccaagaaactagtgctgatgaaatgacattcagagaagggcatcagtgggagaagattcctctgagtggcagtaaccaggaaataagaagacagaaggagaggattactgagcagcctctcaaagaggaagaagatgaggacaggaagaacaaaggtcaccaggcagctgaaattgaatggctgggatttcgaaaacctagccaagctgacatgttacattctaaacatgatgaggagcagaaggtttgggatgaagaaattgatgatgatgatgatgataattgcaataatgatgaagatgaagttcgagtgatagaatttaagaaaaaacatgaagaggtttctcaatttaaagaggaaggtgatgcaagtgaggactccccactgagcagtgccagttcccaagctgtgacacctgatgagcagccaaccttagggaagaagagtgatatctccagaaatgcttattccagatacaatacaatatcctatcggaaaatcagaaagggaaataccaagcaaagaattgatgaattcgagtctatgatgcatttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - biliverdin reductase A
- uridine phosphorylase 2
- adenosine A3 receptor
- UBX domain protein 11

Buy ERMN-ermin, ERM-like protein Gene now

Add to cart