XBP1-X-box binding protein 1 Gene View larger

XBP1-X-box binding protein 1 Gene

New product

820,29 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of XBP1-X-box binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about XBP1-X-box binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000938
Product type: DNA & cDNA
Ncbi symbol: XBP1
Origin species: Human
Product name: XBP1-X-box binding protein 1 Gene
Size: 2ug
Accessions: BC000938
Gene id: 7494
Gene description: X-box binding protein 1
Synonyms: TREB-5; TREB5; XBP-1; XBP2; X-box-binding protein 1; tax-responsive element-binding protein 5; X-box binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggtggtggcagccgcgccgaacccggccgacgggacccctaaagttctgcttctgtcggggcagcccgcctccgccgccggagccccggccggccaggccctgccgctcatggtgccagcccagagaggggccagcccggaggcagcgagcggggggctgccccaggcgcgcaagcgacagcgcctcacgcacctgagccccgaggagaaggcgctgaggaggaaactgaaaaacagagtagcagctcagactgccagagatcgaaagaaggctcgaatgagtgagctggaacagcaagtggtagatttagaagaagagaaccaaaaacttttgctagaaaatcagcttttacgagagaaaactcatggccttgtagttgagaaccaggagttaagacagcgcttggggatggatgccctggttgctgaagaggaggcggaagccaaggggaatgaagtgaggccagtggccgggtctgctgagtccgcagcactcagactacgtgcacctctgcagcaggtgcaggcccagttgtcacccctccagaacatctccccatggattctggcggtattgactcttcagattcagagtctgatatcctgttgggcattctggacaacttggacccagtcatgttcttcaaatgcccttccccagagcctgccagcctggaggagctcccagaggtctacccagaaggacccagttccttaccagcctccctttctctgtcagtggggacgtcatcagccaagctggaagccattaatgaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kinesin family member 6
- RAD1 homolog (S. pombe)
- ermin, ERM-like protein
- biliverdin reductase A

Buy XBP1-X-box binding protein 1 Gene now

Add to cart