RIT2-Ras-like without CAAX 2 Gene View larger

RIT2-Ras-like without CAAX 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RIT2-Ras-like without CAAX 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RIT2-Ras-like without CAAX 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018060
Product type: DNA & cDNA
Ncbi symbol: RIT2
Origin species: Human
Product name: RIT2-Ras-like without CAAX 2 Gene
Size: 2ug
Accessions: BC018060
Gene id: 6014
Gene description: Ras-like without CAAX 2
Synonyms: GTP-binding protein Rit2; RIBA; RIN; ROC2; GTP-binding protein Roc2; Ric-like, expressed in neurons; ras-like protein expressed in neurons; ras-like without CAAX protein 2; Ras like without CAAX 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtagaaaatgaagccagctgctccccgggcagcgcatcaggcgggtccagagagtacaaggtggtaatgctgggagcagggggagttggtaaaagcgcaatgacaatgcagtttattagtcatcagttccctgattatcatgaccctactatagaagatgcttataagacccaggtcaggattgacaatgagccagcttacttggacatcttggacactgctggccaggcagaattcacagccatgcgggagcagtacatgcgaggtggggaaggcttcatcatctgctactccgtcactgaccgtcaatcatttcaggaggctgccaagtttaaagagctcatttttcaggtccgccacacctatgaaattcccctggtgctggtgggtaacaaaattgatctggaacagttccgccaggtttctacagaagaaggcttgagtcttgcccaagaatataattgtggtttttttgagacctctgcagccctcagattctgtattgatgatgcttttcatggcttagtgagggaaattcgcaagaaggagtccatgccatccttgatggaaaagaaactgaagagaaaagactgcctgtggaagaagctcaaaggttctttgaagaagaagagagaaaatatgacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 32
- zinc finger protein 99
- ring finger protein 32
- X-box binding protein 1

Buy RIT2-Ras-like without CAAX 2 Gene now

Add to cart