Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RIT2-Ras-like without CAAX 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RIT2-Ras-like without CAAX 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018060 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIT2 |
| Origin species: | Human |
| Product name: | RIT2-Ras-like without CAAX 2 Gene |
| Size: | 2ug |
| Accessions: | BC018060 |
| Gene id: | 6014 |
| Gene description: | Ras-like without CAAX 2 |
| Synonyms: | GTP-binding protein Rit2; RIBA; RIN; ROC2; GTP-binding protein Roc2; Ric-like, expressed in neurons; ras-like protein expressed in neurons; ras-like without CAAX protein 2; Ras like without CAAX 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggtagaaaatgaagccagctgctccccgggcagcgcatcaggcgggtccagagagtacaaggtggtaatgctgggagcagggggagttggtaaaagcgcaatgacaatgcagtttattagtcatcagttccctgattatcatgaccctactatagaagatgcttataagacccaggtcaggattgacaatgagccagcttacttggacatcttggacactgctggccaggcagaattcacagccatgcgggagcagtacatgcgaggtggggaaggcttcatcatctgctactccgtcactgaccgtcaatcatttcaggaggctgccaagtttaaagagctcatttttcaggtccgccacacctatgaaattcccctggtgctggtgggtaacaaaattgatctggaacagttccgccaggtttctacagaagaaggcttgagtcttgcccaagaatataattgtggtttttttgagacctctgcagccctcagattctgtattgatgatgcttttcatggcttagtgagggaaattcgcaagaaggagtccatgccatccttgatggaaaagaaactgaagagaaaagactgcctgtggaagaagctcaaaggttctttgaagaagaagagagaaaatatgacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ring finger protein 32 - zinc finger protein 99 - ring finger protein 32 - X-box binding protein 1 |