Login to display prices
Login to display prices
RIT2-Ras-like without CAAX 2 Gene View larger

RIT2-Ras-like without CAAX 2 Gene

PTXBC018060

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RIT2-Ras-like without CAAX 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RIT2-Ras-like without CAAX 2 Gene

Proteogenix catalog: PTXBC018060
Ncbi symbol: RIT2
Product name: RIT2-Ras-like without CAAX 2 Gene
Size: 2ug
Accessions: BC018060
Gene id: 6014
Gene description: Ras-like without CAAX 2
Synonyms: GTP-binding protein Rit2; RIBA; RIN; ROC2; GTP-binding protein Roc2; Ric-like, expressed in neurons; ras-like protein expressed in neurons; ras-like without CAAX protein 2; Ras like without CAAX 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggtagaaaatgaagccagctgctccccgggcagcgcatcaggcgggtccagagagtacaaggtggtaatgctgggagcagggggagttggtaaaagcgcaatgacaatgcagtttattagtcatcagttccctgattatcatgaccctactatagaagatgcttataagacccaggtcaggattgacaatgagccagcttacttggacatcttggacactgctggccaggcagaattcacagccatgcgggagcagtacatgcgaggtggggaaggcttcatcatctgctactccgtcactgaccgtcaatcatttcaggaggctgccaagtttaaagagctcatttttcaggtccgccacacctatgaaattcccctggtgctggtgggtaacaaaattgatctggaacagttccgccaggtttctacagaagaaggcttgagtcttgcccaagaatataattgtggtttttttgagacctctgcagccctcagattctgtattgatgatgcttttcatggcttagtgagggaaattcgcaagaaggagtccatgccatccttgatggaaaagaaactgaagagaaaagactgcctgtggaagaagctcaaaggttctttgaagaagaagagagaaaatatgacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: