Login to display prices
Login to display prices
TFEC-transcription factor EC Gene View larger

TFEC-transcription factor EC Gene

PTXBC029891

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFEC-transcription factor EC Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TFEC-transcription factor EC Gene

Proteogenix catalog: PTXBC029891
Ncbi symbol: TFEC
Product name: TFEC-transcription factor EC Gene
Size: 2ug
Accessions: BC029891
Gene id: 22797
Gene description: transcription factor EC
Synonyms: TFEC-L; TCFEC; TFE-C; TFECL; bHLHe34; hTFEC-L; transcription factor EC; class E basic helix-loop-helix protein 34
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccttgatcatcagatcatcaatccaactcttaaatggtcacaacctgcagtgccaagtggtgggcctcttgtgcagcatgcacacacaactctggacagtgatgctggcctcacagaaaacccactcaccaagttactagctattgggaaagaagatgacaatgcacaatggcatttatctggaagtattttggatgtgtatagcggtgaacaaggaatttcaccaattaacatggggcttacaagtgcttcttgtccaagtagtctaccaatgaaaagagaaattacagaaactgacactagagctttagcaaaagagagacaaaaaaaggacaaccacaacctcattgaaagaagaagaaggtataatattaattaccgaatcaaggagcttggcactcttattccaaagtctaatgatcctgatatgcgctggaacaaaggaaccattctaaaagcatcagtggagtacatcaagtggctacaaaaagaacaacagagagcccgagaattggaacacagacagaagaaattagagcaggctaacaggcgacttctacttcggattcaggtttttataagaatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice