Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SMR3B-submaxillary gland androgen regulated protein 3B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMR3B-submaxillary gland androgen regulated protein 3B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015327 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMR3B |
| Origin species: | Human |
| Product name: | SMR3B-submaxillary gland androgen regulated protein 3B Gene |
| Size: | 2ug |
| Accessions: | BC015327 |
| Gene id: | 10879 |
| Gene description: | submaxillary gland androgen regulated protein 3B |
| Synonyms: | PBII; PRL3; PROL3; SMR1B; submaxillary gland androgen-regulated protein 3B; proline rich 3; proline-rich peptide P-B; proline-rich protein 3; salivary proline-rich protein; submaxillary gland androgen regulated protein 3 homolog B; submaxillary gland androgen regulated protein 3B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaatcactgacttggatcttgggcctttgggctcttgcagcgtgtttcacacctggtgagagtcaaagaggccccaggggaccatatccacctggaccgctggctcctcctcaaccttttggcccaggatttgttccaccacctcctcctccaccctatggtccagggagaatcccacctcctcctcccgcaccctatggtccagggatatttccaccaccccctcctcaaccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FXYD domain containing ion transport regulator 7 - angiogenic factor with G patch and FHA domains 1 - cyclin-dependent kinase 2 associated protein 1 - thyroid hormone responsive (SPOT14 homolog, rat) |