SMR3B-submaxillary gland androgen regulated protein 3B Gene View larger

SMR3B-submaxillary gland androgen regulated protein 3B Gene

PTXBC015327

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SMR3B-submaxillary gland androgen regulated protein 3B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SMR3B-submaxillary gland androgen regulated protein 3B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015327
Product type: DNA & cDNA
Ncbi symbol: SMR3B
Origin species: Human
Product name: SMR3B-submaxillary gland androgen regulated protein 3B Gene
Size: 2ug
Accessions: BC015327
Gene id: 10879
Gene description: submaxillary gland androgen regulated protein 3B
Synonyms: PBII; PRL3; PROL3; SMR1B; submaxillary gland androgen-regulated protein 3B; proline rich 3; proline-rich peptide P-B; proline-rich protein 3; salivary proline-rich protein; submaxillary gland androgen regulated protein 3 homolog B; submaxillary gland androgen regulated protein 3B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatcactgacttggatcttgggcctttgggctcttgcagcgtgtttcacacctggtgagagtcaaagaggccccaggggaccatatccacctggaccgctggctcctcctcaaccttttggcccaggatttgttccaccacctcctcctccaccctatggtccagggagaatcccacctcctcctcccgcaccctatggtccagggatatttccaccaccccctcctcaaccctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FXYD domain containing ion transport regulator 7
- angiogenic factor with G patch and FHA domains 1
- cyclin-dependent kinase 2 associated protein 1
- thyroid hormone responsive (SPOT14 homolog, rat)

Buy SMR3B-submaxillary gland androgen regulated protein 3B Gene now

Add to cart