FXYD7-FXYD domain containing ion transport regulator 7 Gene View larger

FXYD7-FXYD domain containing ion transport regulator 7 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FXYD7-FXYD domain containing ion transport regulator 7 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FXYD7-FXYD domain containing ion transport regulator 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018619
Product type: DNA & cDNA
Ncbi symbol: FXYD7
Origin species: Human
Product name: FXYD7-FXYD domain containing ion transport regulator 7 Gene
Size: 2ug
Accessions: BC018619
Gene id: 53822
Gene description: FXYD domain containing ion transport regulator 7
Synonyms: FXYD domain-containing ion transport regulator 7; FXYD domain containing ion transport regulator 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccccgacccagacccccacaaaggctcctgaggaacctgacccattttactatgactacaacacggtgcagactgtgggcatgactctggcaaccatcttgttcctgctgggtatcctcatcgtcatcagcaagaaggtgaagtgcaggaaggcggactccaggtctgagagcccaacctgcaaatcctgtaagtctgagcttccctcttcagcccctggtggcggcggcgtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - angiogenic factor with G patch and FHA domains 1
- cyclin-dependent kinase 2 associated protein 1
- thyroid hormone responsive (SPOT14 homolog, rat)
- P antigen family, member 1 (prostate associated)

Buy FXYD7-FXYD domain containing ion transport regulator 7 Gene now

Add to cart