Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FXYD7-FXYD domain containing ion transport regulator 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FXYD7-FXYD domain containing ion transport regulator 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018619 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FXYD7 |
| Origin species: | Human |
| Product name: | FXYD7-FXYD domain containing ion transport regulator 7 Gene |
| Size: | 2ug |
| Accessions: | BC018619 |
| Gene id: | 53822 |
| Gene description: | FXYD domain containing ion transport regulator 7 |
| Synonyms: | FXYD domain-containing ion transport regulator 7; FXYD domain containing ion transport regulator 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaccccgacccagacccccacaaaggctcctgaggaacctgacccattttactatgactacaacacggtgcagactgtgggcatgactctggcaaccatcttgttcctgctgggtatcctcatcgtcatcagcaagaaggtgaagtgcaggaaggcggactccaggtctgagagcccaacctgcaaatcctgtaagtctgagcttccctcttcagcccctggtggcggcggcgtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - angiogenic factor with G patch and FHA domains 1 - cyclin-dependent kinase 2 associated protein 1 - thyroid hormone responsive (SPOT14 homolog, rat) - P antigen family, member 1 (prostate associated) |