Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NRGN-neurogranin (protein kinase C substrate, RC3) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NRGN-neurogranin (protein kinase C substrate, RC3) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002835 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NRGN |
| Origin species: | Human |
| Product name: | NRGN-neurogranin (protein kinase C substrate, RC3) Gene |
| Size: | 2ug |
| Accessions: | BC002835 |
| Gene id: | 4900 |
| Gene description: | neurogranin (protein kinase C substrate, RC3) |
| Synonyms: | RC3; hng; calmodulin-binding protein; neurogranin (protein kinase C substrate, RC3); protein kinase C substrate |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggactgctgcaccgagaacgcctgctccaagccggacgacgacattctagacatcccgctggacgatcccggcgccaacgcggccgccgccaaaatccaggcgagttttcggggccacatggcgcggaagaagataaagagcggagagcgcggccggaagggcccgggccctggggggcctggcggagctggggtggcccggggaggcgcgggcggcggccccagcggagactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin, light chain 1, alkali; skeletal, fast - Rho GDP dissociation inhibitor (GDI) alpha - DnaJ (Hsp40) homolog, subfamily A, member 4 - receptor (chemosensory) transporter protein 4 |