PTXBC005302
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005302 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FXYD2 |
| Origin species: | Human |
| Product name: | FXYD2-FXYD domain containing ion transport regulator 2 Gene |
| Size: | 2ug |
| Accessions: | BC005302 |
| Gene id: | 486 |
| Gene description: | FXYD domain containing ion transport regulator 2 |
| Synonyms: | ATP1G1; HOMG2; sodium/potassium-transporting ATPase subunit gamma; ATPase, Na+/K+ transporting, gamma 1 polypeptide; Na(+)/K(+) ATPase subunit gamma; sodium pump gamma chain; FXYD domain containing ion transport regulator 2 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaggtggtacctgggcggcagccccaagggggacgtggacccgttctactatgactatgagaccgttcgcaatgggggcctgatcttcgctggactggccttcatcgtggggctcctcatcctcctcagcagaagattccgctgtgggggcaataagaagcgcaggcaaatcaatgaagatgagccgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - submaxillary gland androgen regulated protein 3B - FXYD domain containing ion transport regulator 7 - angiogenic factor with G patch and FHA domains 1 - cyclin-dependent kinase 2 associated protein 1 |