IGF1R-insulin-like growth factor 1 receptor Gene View larger

IGF1R-insulin-like growth factor 1 receptor Gene

PTXBC010607

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGF1R-insulin-like growth factor 1 receptor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGF1R-insulin-like growth factor 1 receptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010607
Product type: DNA & cDNA
Ncbi symbol: IGF1R
Origin species: Human
Product name: IGF1R-insulin-like growth factor 1 receptor Gene
Size: 2ug
Accessions: BC010607
Gene id: 3480
Gene description: insulin-like growth factor 1 receptor
Synonyms: soluble IGF1R variant 2; soluble IGF1R variant 1; CD221; IGFIR; IGFR; JTK13; insulin-like growth factor 1 receptor; IGF-I receptor; insulin like growth factor 1 receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaacagccgaggtgttggagcccagcagtgcatggcaccgttcggcatctggcttgattggtctggctgccgtcattgtcagcacagtgccatggacatgggaagacttgactgcacagccaatggttttcatgatgattacagcatacacagtgatcacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vesicle-associated membrane protein 4
- vesicle-associated membrane protein 4
- secretory carrier membrane protein 1
- acetyl-Coenzyme A acetyltransferase 1

Buy IGF1R-insulin-like growth factor 1 receptor Gene now

Add to cart