LOC133874-hypothetical gene LOC133874 Gene View larger

LOC133874-hypothetical gene LOC133874 Gene

PTXBC030767

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC133874-hypothetical gene LOC133874 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC133874-hypothetical gene LOC133874 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030767
Product type: DNA & cDNA
Ncbi symbol: LOC133874
Origin species: Human
Product name: LOC133874-hypothetical gene LOC133874 Gene
Size: 2ug
Accessions: BC030767
Gene id: 133874
Gene description: hypothetical gene LOC133874
Synonyms: chromosome 5 open reading frame 58
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagaaattgcagaaattctccctgctcaggaaaaggtagaggcaaggattgacttaaagatgggtaagaagcgtgttactgatcataagctaaatgtggacaaagtaattaaaaatattaacacaatttcttcggagttgaagaagataaaagttaattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - signal recognition particle 9kDa
- inositol hexaphosphate kinase 2
- chemokine (C-C motif) ligand 19
- egl nine homolog 2 (C. elegans)

Buy LOC133874-hypothetical gene LOC133874 Gene now

Add to cart