RPL39L-ribosomal protein L39-like Gene View larger

RPL39L-ribosomal protein L39-like Gene

PTXBC012328

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL39L-ribosomal protein L39-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL39L-ribosomal protein L39-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012328
Product type: DNA & cDNA
Ncbi symbol: RPL39L
Origin species: Human
Product name: RPL39L-ribosomal protein L39-like Gene
Size: 2ug
Accessions: BC012328
Gene id: 116832
Gene description: ribosomal protein L39-like
Synonyms: RPL39L1; 60S ribosomal protein L39-like; 60S ribosomal protein L39-2; L39-2; ribosomal protein L39-like 1; ribosomal protein L39-like protein; ribosomal protein L39 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttctcacaagactttcaccattaagcgattcctggccaagaaacaaaagcaaaatcgtcccatcccccagtggattcagatgaaacctggtagtaaaatcaggtacaactccaaaaggaggcattggagaagaaccaagctgggtctataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 14A
- transmembrane protein 141
- transmembrane protein 14B
- transmembrane protein 14B

Buy RPL39L-ribosomal protein L39-like Gene now

Add to cart