TMEM141-transmembrane protein 141 Gene View larger

TMEM141-transmembrane protein 141 Gene

PTXBC007834

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM141-transmembrane protein 141 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM141-transmembrane protein 141 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007834
Product type: DNA & cDNA
Ncbi symbol: TMEM141
Origin species: Human
Product name: TMEM141-transmembrane protein 141 Gene
Size: 2ug
Accessions: BC007834
Gene id: 85014
Gene description: transmembrane protein 141
Synonyms: transmembrane protein 141
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgaacttgggtctgtcccgggtggacgacgccgtggctgccaagcacccgggactcggggagtatgccgcatgccagtcacacgccttcatgaagggcgttttcaccttcgtcacaggcaccggcatggcctttggcttgcagatgttcattcagaggaagtttccataccctttgcagtggagcctcctagtggccgtggttgcaggctctgtggtcagctacggggtgacgagagtggagtcggagaaatgcaacaacctctggctcttcctggagaccgggcagctccccaaagacaggagcacagatcagagaagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 14B
- transmembrane protein 14B
- histone cluster 1, H2bn
- histone cluster 1, H2bc

Buy TMEM141-transmembrane protein 141 Gene now

Add to cart