TMEM14B-transmembrane protein 14B Gene View larger

TMEM14B-transmembrane protein 14B Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM14B-transmembrane protein 14B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM14B-transmembrane protein 14B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001033
Product type: DNA & cDNA
Ncbi symbol: TMEM14B
Origin species: Human
Product name: TMEM14B-transmembrane protein 14B Gene
Size: 2ug
Accessions: BC001033
Gene id: 81853
Gene description: transmembrane protein 14B
Synonyms: transmembrane protein 14B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaagcccctcttcccattagtgcctttgcattggtttggctttggctacacagcactggttgtttctggtgggatcgttggctatgtaaaaacaggcagcgtgccgtccctggctgcatggctgctcttcggcagtctagccggcctgggtgcttaccagctgtatcaggatccaaggaacgtttggggtttcctagccgctacatctgttacttttgttggtgttatgggaatgagatcctactactatggaaaattcatgcctgtaggtttaattgcaggtgccagtttgctgatggccgccaaagttggagttcgtatgttgatgacatctgattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 14B
- histone cluster 1, H2bn
- histone cluster 1, H2bc
- SUB1 homolog (S. cerevisiae)

Buy TMEM14B-transmembrane protein 14B Gene now

Add to cart