TMEM14A-transmembrane protein 14A Gene View larger

TMEM14A-transmembrane protein 14A Gene

PTXBC015097

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM14A-transmembrane protein 14A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM14A-transmembrane protein 14A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015097
Product type: DNA & cDNA
Ncbi symbol: TMEM14A
Origin species: Human
Product name: TMEM14A-transmembrane protein 14A Gene
Size: 2ug
Accessions: BC015097
Gene id: 28978
Gene description: transmembrane protein 14A
Synonyms: C6orf73; PTD011; transmembrane protein 14A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacctgatcggttttggttatgcagccctcgtgacatttggaagcatttttggatataagcggagaggtggtgttccgtctttgattgctggtctttttgttggatgtttggccggctatggagcttaccgtgtctccaatgacaaacgagatgtaaaagtgtcactgtttacagctttcttcctggctaccataatgggtgtgagatttaagaggtccaagaaaataatgcctgctggtttggttgcaggtttaagcctcatgatgatcctgagacttgtcttgttgctgctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 141
- transmembrane protein 14B
- transmembrane protein 14B
- histone cluster 1, H2bn

Buy TMEM14A-transmembrane protein 14A Gene now

Add to cart