CBFA2T2-core-binding factor, runt domain, alpha subunit 2, translocated to, 2 Gene View larger

CBFA2T2-core-binding factor, runt domain, alpha subunit 2, translocated to, 2 Gene


New product

Data sheet of CBFA2T2-core-binding factor, runt domain, alpha subunit 2, translocated to, 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CBFA2T2-core-binding factor, runt domain, alpha subunit 2, translocated to, 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040344
Product type: DNA & cDNA
Ncbi symbol: CBFA2T2
Origin species: Human
Product name: CBFA2T2-core-binding factor, runt domain, alpha subunit 2, translocated to, 2 Gene
Size: 2ug
Accessions: BC040344
Gene id: 9139
Gene description: core-binding factor, runt domain, alpha subunit 2; translocated to, 2
Synonyms: protein CBFA2T2; EHT; MTGR1; ZMYND3; p85; ETO homolog on chromosome 20; ETO homologous on chromosome 20; MTG8-like protein; MTG8-related protein 1; core-binding factor, runt domain, alpha subunit 2; translocated to, 2; myeloid translocation gene-related protein 1; myeloid translocation-related protein 1; CBFA2/RUNX1 translocation partner 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtttcaccatgttggccaggctcgtcttgaactcctgacctcaggtgatctgcctgcattggcctcccaacgtgctgggattacagttggtcctgagaaaagggtgccagcgatgcctggatcgcctgtggaagtgaagatacagtccagatcctcacctcccaccatgccacccctcccaccaataaatcctggaggaccgaggccagtgtccttcactcctactgcattaagcaatggcatcaaccattctcctcctaccctgaatggtgccccatcaccgccacagagattcagcaatggtcctgcctcctccacatcatctgcactcacaaatcagcaattgccagccacttgtggtgctcgacaactcagcaagttgaaacgctttcttaccactctgcaacagtttggcaatgacatctcccctgagattggggagaaggtgcggactcttgttcttgcactggtgaactcaacagtgacaattgaggaattccactgtaagctccaagaagccacaaactttccccttcgtccttttgtgattccatttctcaaggccaacctgcccctgctgcagcgggaactgctgcactgcgctcgggcggccaagcagaccccatcccagtacctggctcagcacgaacaccttctgctcaacacaagcattgcatcgcctgctgactcgtcagagttgctcatggaggtgcacggaaatgggaagaggcccagtccagagaggagagaagagaatagttttgatagagacacaattgctcctgagcctcctgccaagagagtatgtaccatcagccctgctcctcggcacagtcctgctctcactgtgcccctcatgaatcctgggggccaattccatcctacccctccacctcttcagcattacaccttagaggatattgcaacttctcacctgtatcgggaacccaacaagatgctagagcatcgagaagttcgtgatagacaccacagtcttggtctaaatggaggctatcaagatgagttggtagatcatcgtttgacagaaagggaatgggctgatgaatggaaacatcttgaccatgcgctgaattgcattatggaaatggtagagaaaacaaggcgctctatggcagttctgcggcgctgtcaggaatcagatcgtgaagaactcaactactggaaaagacggtacaatgaaaacacagagctgaggaaaacggggaccgagttggtctccaggcagcacagccctgggagtgcagattctctcagcaatgattctcagagagagttcaacagcaggccaggtacaggatacgtacctgtggagttttggaaaaaaacagaagaagctgtgaataaggtgaaaattcaggccatgtcagaagtacagaaggccgtcgctgaggcagagcagaaagcctttgaagtgattgcaacagagagagcacgaatggagcaaaccatagcggatgtcaagcggcaggccgcagaggatgctttcctcgtcatcaatgagcaagaggagtccacggagaactgctggaactgtggccgcaaagccagcgagacatgcagtggctgcaatatcgcgcgatactgtggctctttctgccagcacaaggactgggagcggcaccaccgcctctgtggtcagaacctgcatggccagagcccccacggccagggccggccgctgcttcctgtaggcaggggctcctctgccaggtccgccgactgcagcgtgcccagcccagccctcgacaagacctcggcaaccacatcgcgttcctcaacacctgcttctgtgacagctatcgacaccaacggactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - core-binding factor, runt domain, alpha subunit 2; translocated to, 2
- aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
- aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
- sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)

Buy CBFA2T2-core-binding factor, runt domain, alpha subunit 2, translocated to, 2 Gene now

Add to cart