Login to display prices
Login to display prices
SPAM1-sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) Gene View larger

SPAM1-sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) Gene

PTXBC026163

New product

Data sheet of SPAM1-sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPAM1-sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC026163
Ncbi symbol: SPAM1
Product name: SPAM1-sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) Gene
Size: 2ug
Accessions: BC026163
Gene id: 6677
Gene description: sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
Synonyms: HEL-S-96n; HYA1; HYAL1; HYAL3; HYAL5; PH-20; PH20; SPAG15; hyaluronidase PH-20; PH-20 hyaluronidase; epididymis secretory sperm binding protein Li 96n; hyal-PH20; hyaluronoglucosaminidase PH-20; sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding); sperm surface protein PH-20; sperm adhesion molecule 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagtgctaaaattcaagcacatctttttcagaagctttgttaaatcaagtggagtatcccagatagttttcaccttccttctgattccatgttgcttgactctgaatttcagagcacctcctgttattccaaatgtgcctttcctctgggcctggaatgccccaagtgaattttgtcttggaaaatttgatgagccactagatatgagcctcttctctttcataggaagcccccgaataaacgccaccgggcaaggtgttacaatattttatgttgatagacttggctactatccttacatagattcaatcacaggagtaactgtgaatggaggaatcccccagaagatttccttacaagaccatctggacaaagctaagaaagacattacattttatatgccagtagacaatttgggaatggctgttattgactgggaagaatggagacccacttgggcaagaaactggaaacctaaagatgtttacaagaataggtctattgaattggttcagcaacaaaatgtacaacttagtctcacagaggccactgagaaagcaaaacaagaatttgaaaaagcagggaaggatttcctggtagagactataaaattgggaaaattacttcggccaaatcacttgtggggttattatctttttccggattgttacaaccatcactataagaaacccggttacaatggaagttgcttcaatgtagaaataaaaagaaatgatgatctcagctggttgtggaatgaaagcactgctctttacccatccatttatttgaacactcagcagtctcctgtagctgctacactctatgtgcgcaatcgagttcgggaagccatcagagtttccaaaatacctgatgcaaaaagtccacttccggtttttgcatatacccgcatagtttttactgatcaagttttgaaattcctttctcaagatgaacttgtgtatacatttggcgaaactgttgctctgggtgcttctggaattgtaatatggggaaccctcagtataatgcgaagtatgaaatcttgcttgctcctagacaattacatggagactatactgaatccttacataatcaacgtcacactagcagccaaaatgtgtagccaagtgctttgccaggagcaaggagtgtgtataaggaaaaactggaattcaagtgactatcttcacctcaacccagataattttgctattcaacttgagaaaggtggaaagttcacagtacgtggaaaaccgacacttgaagacctggagcaattttctgaaaaattttattgcagctgttatagcaccttgagttgtaaggagaaagctgatgtaaaagacactgatgctgttgatgtgtgtattgctgatggtgtctgtatagatgcttttctaaaacctcccatggagacagaagaacctcaaattttctacaatgcttcaccctccacactatctgccacaatgttcatttggaggctggaagtctgggatcaaggtattagcagaattggtttcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: