CSTF2T-cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant Gene View larger

CSTF2T-cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant Gene

PTXBC028239

New product

Data sheet of CSTF2T-cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CSTF2T-cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC028239
Product type: DNA & cDNA
Ncbi symbol: CSTF2T
Origin species: Human
Product name: CSTF2T-cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant Gene
Size: 2ug
Accessions: BC028239
Gene id: 23283
Gene description: cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
Synonyms: CstF-64T; cleavage stimulation factor subunit 2 tau variant; CF-1 64 kDa subunit tau; CSTF 64 kDa subunit tau; cleavage stimulation factor 64 kDa subunit tau; cleavage stimulation factor subunit 2, tau; cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau; cleavage stimulation factor, 3' pre-RNA, subunit 2, tau; tauCstF-64
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgagtttggcggtgagagacccggcaatggatcgatcactgcgttccgtgttcgtggggaacattccatatgaggcaactgaggagcagttaaaggacattttctcggaggttggttctgttgtcagtttccggctggtatacgatagagagacgggaaaacccaagggctatggcttctgcgaataccaagaccaggagaccgcgcttagtgccatgcggaacctcaatgggcgggagttcagtgggagagcgcttcgggtggacaatgctgccagtgaaaagaataaggaggagttaaagagcctcgggcctgcagcgcccattattgactcaccctatggggatcccatcgatccagaagatgcccctgaatcgattaccagagcagtagccagtctccccccggagcagatgtttgagctgatgaagcagatgaagctctgtgtccaaaacagccaccaggaagctcgaaacatgttacttcaaaatccacaactggcttatgcactgttgcaggcacaagtagtgatgagaatcatggatccagagattgctctgaaaattctgcatcggaagatacatgtcacaccactgatcccaggcaaatctcagtctgtgtctgtctctggccctggccctggccctggccctgggctctgcccaggacctaatgttctgctgaaccagcagaatcctccagctcctcagcctcagcatttggctagaagacctgtgaaggacattcctcctctgatgcagactcctatccagggtggaattccagctccagggccaataccagctgcagttcccggagctggtcctggttccttaactcctggaggagcaatgcagccccaacttggaatgccaggggttggcccagtgcctttagagcggggacaagtgcagatgtcagatcctagagctcctatacctcgcggacccgtgactcctggtggtctgcctcctcgaggactgttaggagatgctccaaatgacccacgtggagggactttgctttcagtcactggagaagtggagcccagaggttatctgggtccaccccatcagggtccccccatgcatcatgcctctggtcatgacactcgtggcccttcctcacatgagatgaggggagggccattaggagatcccagactgctaattggagagcccagaggccccatgatagatcaaaggggtctacctatggatggtagaggtggtagagattctcgagcgatggagactcgcgccatggaaactgaggtcttagagacacgtgtaatggagaggagaggaatggagacctgtgcgatggaaaccagagggatggaagcaaggggcatggatgcaagaggattggagatgaggggccctgtccccagttcaagaggccctatgactggtggaattcagggtcctggtcccattaatataggggcaggtggccctcctcagggacccagacaggtcccaggcatttcaggggtggggaatcctggagctggtatgcagggtacaggcatacaaggaacaggcatgcagggagcaggcatacaaggaggagggatgcagggggcaggcatacaaggagtcagtatacaaggaggaggtatacaaggaggaggtatacagggggcaagcaggcaaggtggaagccagcctagcagttttagtcctgggcagagccaggtcactccacaggatcaggagaaggcagctttgatcatgcaggttcttcaactgactgcagatcagattgccatgctgccccctgagcaaaggcagagtatcctgattttaaaggaacaaatccagaaatccactggagcgtcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 4E nuclear import factor 1
- eukaryotic translation initiation factor 4E nuclear import factor 1
- mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
- DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae)

Buy CSTF2T-cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant Gene now

Add to cart