AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene View larger

AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

PTXBC031562

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031562
Product type: DNA & cDNA
Ncbi symbol: AKR7A3
Origin species: Human
Product name: AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene
Size: 2ug
Accessions: BC031562
Gene id: 22977
Gene description: aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
Synonyms: AFAR2; aflatoxin B1 aldehyde reductase member 3; AFB1 aldehyde reductase 2; AFB1-AR 2; aflatoxin B1 aldehyde reductase 2; aflatoxin aldehyde reductase; aldo-keto reductase family 7 member A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccggcagctgtcgcgggcccggccagccacggtgctgggcgccatggagatggggcgccgcatggacgcgcccaccagcgccgcagtcacgcgcgccttcctggagcgcggccacaccgagatagacacggccttcgtgtacagcgagggccagtccgagaccatccttggcggcctggggctccggctgggcggcagcgactgcagagtgaaaattgataccaaggccattccactgtttgggaactccctgaagcctgacagtctccggttccagctggagacgtcactgaagcggctgcagtgtccccgagtggacctcttctacctgcatatgccagaccacagcaccccggtggaagagacactgcgtgcctgccaccagctgcaccaggagggcaagttcatggagcttggcctctccaactatgcagcctgggaagtggccgagatctgtaccctctgcaagagcaacggctggatcctgcccactgtgtaccagggcatgtacaatgccatcacccggcaggtggaaacggagctcttcccctgcctcaggcactttggactgaggttctatgccttcaaccctctggctgggggcctgctgaccggcaagtacaagtatgaggacaagaatgggaaacagcccgtgggccgcttctttgggaatacctgggcagagatgtacaggaatcgctactggaaggagcaccactttgagggcattgccctggtggagaaggccctgcaggccgcgtatggcgccagcgcccccagcatgacctcggccaccctccggtggatgtaccaccactcacagctgcagggtgcccacggggacgcggtcatcctgggcatgtccagcctggagcagctggagcagaacttggcagcggcagaggaagggcccctggagccggctgtcgtggatgcctttaatcaagcctggcatttggttactcacgaatgtcccaactacttccgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
- cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
- eukaryotic translation initiation factor 4E nuclear import factor 1
- eukaryotic translation initiation factor 4E nuclear import factor 1

Buy AKR7A3-aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) Gene now

Add to cart