Login to display prices
Login to display prices
AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene View larger

AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene

PTXBC004111

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004111
Product type: DNA & cDNA
Ncbi symbol: AKR7A2
Origin species: Human
Product name: AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene
Size: 2ug
Accessions: BC004111
Gene id: 8574
Gene description: aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)
Synonyms: AFAR; AFAR1; AFB1-AR1; AKR7; aflatoxin B1 aldehyde reductase member 2; AFB1 aldehyde reductase 1; AFB1-AR 1; HEL-S-166mP; SSA reductase; aflatoxin aldehyde reductase; aflatoxin beta1 aldehyde reductase; aldoketoreductase 7; epididymis secretory sperm binding protein Li 166mP; succinic semialdehyde reductase; aldo-keto reductase family 7 member A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcccggccaccgccaccgcgggtcgcctcggtgctgggcaccatggagatggggcgccgcatggacgcgcccgccagcgccgcggccgtgcgcgcctttctggagcgcggccacaccgaactggacacggccttcatgtacagcgacggccagtccgagaccatcctgggcggcctggggctcgggctgggcggtggcgactgcagagtgaaaattgccaccaaggccaacccttgggatggaaaatcactaaagcctgacagtgtccggtcccagctggagacgtcattgaagaggctgcagtgtccccaagtggacctcttctacctacacgcacctgaccacggcaccccggtggaagagacgctgcatgcctgccagcggctgcaccaggagggcaagttcgtggagcttggcctctccaactatgctagctgggaagtggccgagatctgtaccctctgcaagagcaatggctggatcctgcccactgtgtaccagggcatgtacaacgccaccacccggcaggtggaaacggagctcttcccctgcctcaggcactttggactgaggttctatgcctacaaccctctggctgggggcctgctgactggcaagtacaagtatgaggacaaggacgggaaacagcctgtgggccgcttctttgggaatagctgggctgagacctacaggaatcgcttctggaaggagcaccacttcgaggccattgcgttggtggagaaggccctgcaggccgcatatggcgccagcgcccccagtgtgacctcggctgccctccggtggatgtaccaccactcacagctgcagggtgcccacggggacgcggtcatcctgggcatgtccagcctggagcagctggagcagaacttggcagcaacagaggaagggcccctggagccggctgtcgtggatgcctttaatcaagcctggcatttggttgctcacgaatgtcccaactacttccgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)
- sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)
- cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant
- eukaryotic translation initiation factor 4E nuclear import factor 1