Login to display prices
Login to display prices
UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene View larger

UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene

PTXBC000484

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene

Proteogenix catalog: PTXBC000484
Ncbi symbol: UQCRC2
Product name: UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene
Size: 2ug
Accessions: BC000484
Gene id: 7385
Gene description: ubiquinol-cytochrome c reductase core protein II
Synonyms: MC3DN5; QCR2; UQCR2; cytochrome b-c1 complex subunit 2, mitochondrial; complex III subunit 2; cytochrome bc-1 complex core protein II; ubiquinol-cytochrome-c reductase complex core protein 2; ubiquinol-cytochrome c reductase core protein II
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctactaaccagagccggctctttctcgagattttattccctcaaagttgcccccaaagttaaagccacagctgcgcctgcaggagcaccgccacaacctcaggaccttgagtttaccaagttaccaaatggcttggtgattgcttctttggaaaactattctcctgtatcaagaattggtttgttcattaaagcaggcagtagatatgaggacttcagcaatttaggaaccacccatttgctgcgtcttacatccagtctgacgacaaaaggagcttcatctttcaagataacccgtggaattgaagcagttggtggcaaattaagtgtgaccgcaacaagggaaaacatggcttatactgtggaatgcctgcggggtgatgttgatattctaatggagttcctgctcaatgtcaccacagcaccagaatttcgtcgttgggaagtagctgaccttcagcctcagctaaagattgacaaagctgtggcctttcagaatccgcagactcatgtcattgaaaatttgcatgcagcagcttaccggaatgccttggctaatcccttgtattgtcctgactataggattggaaaagtgacatcagaggagttacattacttcgttcagaaccatttcacaagtgcaagaatggctttgattggacttggtgtgagtcatcctgttctaaagcaagttgctgaacagtttctcaacatgaggggtgggcttggtttatctggtgcaaaggccaactaccgtggaggtgaaatccgagaacagaatggagacagtcttgtccatgctgcttttgtagcagaaagtgctgtcgcgggaagtgcagaggcaaatgcatttagtgttcttcagcatgtcctcggtgctgggccacatgtcaagaggggcagcaacaccaccagccatctgcaccaggctgttgccaaggcaactcagcagccatttgatgtttctgcatttaatgccagttactcagattctggactctttgggatttatactatctcccaggccacagctgctggagatgttatcaaggctgcctataatcaagtaaaaacaatagctcaaggaaacctttccaacacagatgtccaagctgccaagaacaagctgaaagctggatacctaatgtcagtggagtcttctgagtgtttcctggaagaagtcgggtcccaggctctagttgctggttcttacatgccaccatccacagtccttcagcagattgattcagtggctaatgctgatatcataaatgcggcaaagaagtttgtttctggccagaagtcaatggcagcaagtggaaatttgggacatacaccttttgttgatgagttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: