UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene View larger

UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000484
Product type: DNA & cDNA
Ncbi symbol: UQCRC2
Origin species: Human
Product name: UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene
Size: 2ug
Accessions: BC000484
Gene id: 7385
Gene description: ubiquinol-cytochrome c reductase core protein II
Synonyms: MC3DN5; QCR2; UQCR2; cytochrome b-c1 complex subunit 2, mitochondrial; complex III subunit 2; cytochrome bc-1 complex core protein II; ubiquinol-cytochrome-c reductase complex core protein 2; ubiquinol-cytochrome c reductase core protein II
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctactaaccagagccggctctttctcgagattttattccctcaaagttgcccccaaagttaaagccacagctgcgcctgcaggagcaccgccacaacctcaggaccttgagtttaccaagttaccaaatggcttggtgattgcttctttggaaaactattctcctgtatcaagaattggtttgttcattaaagcaggcagtagatatgaggacttcagcaatttaggaaccacccatttgctgcgtcttacatccagtctgacgacaaaaggagcttcatctttcaagataacccgtggaattgaagcagttggtggcaaattaagtgtgaccgcaacaagggaaaacatggcttatactgtggaatgcctgcggggtgatgttgatattctaatggagttcctgctcaatgtcaccacagcaccagaatttcgtcgttgggaagtagctgaccttcagcctcagctaaagattgacaaagctgtggcctttcagaatccgcagactcatgtcattgaaaatttgcatgcagcagcttaccggaatgccttggctaatcccttgtattgtcctgactataggattggaaaagtgacatcagaggagttacattacttcgttcagaaccatttcacaagtgcaagaatggctttgattggacttggtgtgagtcatcctgttctaaagcaagttgctgaacagtttctcaacatgaggggtgggcttggtttatctggtgcaaaggccaactaccgtggaggtgaaatccgagaacagaatggagacagtcttgtccatgctgcttttgtagcagaaagtgctgtcgcgggaagtgcagaggcaaatgcatttagtgttcttcagcatgtcctcggtgctgggccacatgtcaagaggggcagcaacaccaccagccatctgcaccaggctgttgccaaggcaactcagcagccatttgatgtttctgcatttaatgccagttactcagattctggactctttgggatttatactatctcccaggccacagctgctggagatgttatcaaggctgcctataatcaagtaaaaacaatagctcaaggaaacctttccaacacagatgtccaagctgccaagaacaagctgaaagctggatacctaatgtcagtggagtcttctgagtgtttcctggaagaagtcgggtcccaggctctagttgctggttcttacatgccaccatccacagtccttcagcagattgattcagtggctaatgctgatatcataaatgcggcaaagaagtttgtttctggccagaagtcaatggcagcaagtggaaatttgggacatacaccttttgttgatgagttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PRP4 pre-mRNA processing factor 4 homolog (yeast)
- family with sequence similarity 130, member A1
- kelch repeat and BTB (POZ) domain containing 10
- 3'-phosphoadenosine 5'-phosphosulfate synthase 2

Buy UQCRC2-ubiquinol-cytochrome c reductase core protein II Gene now

Add to cart