KBTBD10-kelch repeat and BTB (POZ) domain containing 10 Gene View larger

KBTBD10-kelch repeat and BTB (POZ) domain containing 10 Gene


New product

Data sheet of KBTBD10-kelch repeat and BTB (POZ) domain containing 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KBTBD10-kelch repeat and BTB (POZ) domain containing 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006534
Product type: DNA & cDNA
Ncbi symbol: KBTBD10
Origin species: Human
Product name: KBTBD10-kelch repeat and BTB (POZ) domain containing 10 Gene
Size: 2ug
Accessions: BC006534
Gene id: 10324
Gene description: kelch repeat and BTB (POZ) domain containing 10
Synonyms: KBTBD10; Krp1; SARCOSIN; kelch-like protein 41; kel-like protein 23; kelch repeat and BTB (POZ) domain containing 10; kelch-related protein 1; sarcomeric muscle protein; kelch like family member 41
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggattcccagcgggaacttgcagaggaactgcggctttaccaatccacccttcttcaggatggtctaaaagatctcctggatgagaaaaaattcatcgattgcaccctaaaagcaggtgacaaaagtcttccttgccacagattgattttgtcagcttgtagtccttacttccgtgagtactttttatctgaaattgatgaggcgaaaaaaaaggaggtagtgctagacaatgtggatcctgctatacttgatttaatcatcaaatacctgtactctgccagtattgatctcaatgacggaaatgtgcaagatatttttgcattggccagccgctttcagatcccctcagtgtttactgtctgcgtttcttatcttcagaaaagacttgctcctggtaactgtctagccatcctaagattaggacttcttcttgactgcccgagactcgccatttctgcccgtgaatttgtgtctgatcgctttgtacagatttgtaaggaagaggactttatgcaactgtctccacaggaactgatctcagtcatttcaaatgacagcctaaatgtagaaaaagaagaagcagtatttgaggcagtgatgaaatgggtgcgaacagacaaggaaaacagggttaaaaaccttagtgaagtgtttgattgtatccgttttcgccttatgacagaaaaatattttaaggatcatgttgagaaagatgatataattaaaagcaacccagacctccagaaaaaaatcaaagttctaaaagatgctttcgcaggcaaactcccagaacctagcaaaaatgccgcgaagactggggctggtgaggtgaatggtgatgttggtgatgaagatttacttcctggttacctgaatgacattcccaggcatggaatgtttgtaaaagacctcatcctcttggttaatgacacagcagcagtggcttatgaccccacggaaaatgaatgctaccttactgcactggctgagcagattcccagaaatcattccagcattgttacccagcaaaatcagatatatgtggtaggaggactatatgtggatgaagaaaataaggatcaacctctacagtcatacttcttccagctcgatagcatagcatctgaatgggttggacttccacctctgccttcagccaggtgtctcttcggtctgggagaggtggatgataaaatctatgtagttgcaggcaaagaccttcaaacagaggcttcgctggattcagtattatgctatgatcctgtggctgcaaaatggaacgaagtaaaaaaactccctatcaaagtctatggccataatgtgatttcacataaagggatgatatattgtctaggaggaaagacagatgacaaaaaatgtacaaacagggtgtttatcttcaaccccaaaaaaggagattggaaagatctggctccaatgaaaattcctcgttccatgtttggagtagcagtccataaaggcaaaattgtgattgcaggaggtgtcactgaagatggtctttcagcttcagttgaagcttttgaccttacaacaaataaatgggatgtaatgaccgaatttccccaagaaagaagctccatcagtttggtcagcctggctggatctctgtatgcaattggtggttttgctatgattcaactggagtctaaagaatttgcacccactgaagtcaatgacatatggaagtatgaagatgataaaaaagaatgggctgggatgttgaaggaaatacgttatgcttcaggagctagttgcctagcaacacgtttaaatctcttcaaactgtctaaactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 3'-phosphoadenosine 5'-phosphosulfate synthase 2
- valyl-tRNA synthetase 2, mitochondrial (putative)
- ubiquitin-conjugating enzyme E2Q family member 2
- family with sequence similarity 103, member A1

Buy KBTBD10-kelch repeat and BTB (POZ) domain containing 10 Gene now

Add to cart