Login to display prices
Login to display prices
PAPSS2-3'-phosphoadenosine 5'-phosphosulfate synthase 2 Gene View larger

PAPSS2-3'-phosphoadenosine 5'-phosphosulfate synthase 2 Gene

PTXBC009894

New product

Data sheet of PAPSS2-3'-phosphoadenosine 5'-phosphosulfate synthase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PAPSS2-3'-phosphoadenosine 5'-phosphosulfate synthase 2 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC009894
Ncbi symbol: PAPSS2
Product name: PAPSS2-3'-phosphoadenosine 5'-phosphosulfate synthase 2 Gene
Size: 2ug
Accessions: BC009894
Gene id: 9060
Gene description: 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms: ATPSK2; BCYM4; SK2; bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 2; 3-prime-phosphoadenosine 5-prime-phosphosulfate synthase 2; ATP sulfurylase/APS kinase 2; ATP sulfurylase/adenosine 5'-phosphosulfate kinase; PAPS synthase 2; PAPS synthetase 2; SK 2; adenosine 5'-phosphosulfate kinase; adenylyl-sulfate kinase; bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthethase 2; sulfate adenylyltransferase; 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggggatcaagaagcaaaagacggagaaccagcagaaatccaccaatgtagtctatcaggcccaccatgtgagcaggaataagagagggcaagtggttggaacaaggggtgggttccgaggatgtaccgtgtggctaacaggtctctctggtgctggaaaaacaacgataagttttgccctggaggagtaccttgtctcccatgccatcccttgttactccctggatggggacaatgtccgtcatggccttaacagaaatctcggattctctcctggggacagagaggaaaatatccgccggattgctgaggtggctaagctgtttgctgatgctggtctggtctgcattaccagctttatttctccattcgcaaaggatcgtgagaatgcccgcaaaatacatgaatcagcagggctgccattctttgaaatatttgtagatgcacctctaaatatttgtgaaagcagagacgtaaaaggcctctataaaagggccagagctggggagattaaaggatttacaggtattgattctgattatgagaaacctgaaactcctgagcgtgtgcttaaaaccaatttgtccacagtgagtgactgtgtccaccaggtagtggaacttctgcaagagcagaacattgtaccctatactataatcaaagatatccacgaactctttgtgccggaaaacaaacttgaccacgtccgagctgaggctgaaactctcccttcattatcaattactaagctggatctccagtgggtccaggttttgagcgaaggctgggccactcccctcaaaggtttcatgcgggagaaggagtacttacaggttatgcactttgacaccctgctagatgatggcgtgatcaacatgagcatccccattgtactgcccgtctctgcagaggataagacacggctggaagggtgcagcaagtttgtcctggcacatggtggacggagggtagctatcttacgagacgctgaattctatgaacacagaaaagaggaacgctgttcccgtgtttgggggacaacatgtacaaaacacccccatatcaaaatggtgatggaaagtggggactggctggttggtggagaccttcaggtgctggagaaaataagatggaatgatgggctggaccaataccgtctgacacctctggagctcaaacagaaatgtaaagaaatgaatgctgatgcggtgtttgcattccagttgcgcaatcctgtccacaatggccatgccctgttgatgcaggacactcgccgcaggctcctagagaggggctacaagcacccggtcctcctactacaccctctgggcggctggaccaaggatgacgatgtgcctctagactggcggatgaagcagcacgcggctgtgctcgaggaaggggtcctggatcccaagtcaaccattgttgccatctttccgtctcccatgttatatgctggccccacagaggtccagtggcactgcaggtcccggatgattgcgggtgccaatttctacattgtggggagggaccctgcaggaatgccccatcctgaaaccaagaaggatctgtatgaacccactcatgggggcaaggtcttgagcatggcccctggcctcacctctgtggaaatcattccattccgagtggctgcctacaacaaagccaaaaaagccatggacttctatgatccagcaaggcacaatgagtttgacttcatctcaggaactcgaatgaggaagctcgcccgggaaggagagaatcccccagatggcttcatggcccccaaagcatggaaggtcctgacagattattacaggtccctggagaagaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: